#Biodiversity150 number 115 of 150 Giant Puffball Mushroom

115/150: The Giant Puffball is right out of a fairytale!

Fungi: Basidiomycota: Agaricomycetes: Agaricales: Agaricaceae: Calvatia: Calvatia gigantea (Batsch) Lloyd 1904

The Giant Puffball appears in the folklore of many cultures due to its large whimsical appearance. On average these mushrooms are 10-70 cm in diameter, but get as big as 150 cm! The Giant Puffball is one of many mushrooms found to develop ‘fairy rings’, which are associated with witchcraft in many cultures. A fairy ring is a perfect circle that is lined with individual mushrooms which are all connected beneath the surface by a shared mycelium. The Giant Puffball forms its fruiting body completely internally, so it does not have a stalk or visible gills which can help discerns it from other mushrooms. The immature puffball is completely white and entirely edible, however once it begins to form spores it becomes brown and inedible very quickly. Despite being common, it is always important to check with a specialist first before consuming mushrooms you find. Happy ‘shrooming this fall! #Canada150 #Biodiversity150

A Giant Puffball shown beside a ruler for scale. Specimen CCDB-24823-A12 – Puslinch Township, Ontario – 4-Sep-2016. Photo Credit CBG Photography Group, Centre for Biodiversity Genomics
Immature Giant Puffballs appear perfectly white and smooth! Photo Credit: Linden Milner goo.gl/hPrqA7
Mushrooms often form fairy rings on flat undisturbed ground, so they love your lawn! Photo Credit: Mrs skippy goo.gl/RtMNLv

Here’s the barcode sequence information for this species:

Process ID: FUNGC001-16

nucleotide sequence

TTATACATTGTCCGGTAAAGGACGATTAGTAGCTGAACAAGCCAGAGAGCAATCATCACAGTGTAGATAATTATCACACTAGTGACGGGACTGCAAACGGTTCCGCTAATGCATTTCAGGAGAGCCGACCTCTATTACAGAGGCCCGCAAACTCCCACCTTCCAAGCCCCATCGCAACTCACAAAAGCTGGAGGGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAAGATTATTATAGGCCCATAGGCCCATTGATNACATTCTACAACATACTATGTGGTATATGAAAACATAGTGCTCGAAGGAGAGGTTTACAAGTCACTTTGAGAAGAGCTGTATGCTTTCGCACTCAGCAATCCTCACATCCGGAAAGGCCACATAGCCGTCCGATAGTTGACTGCTCTCAACCCCCAAGACTACAAAAGGTGCACAGGTGGATGAATAGAGTCAAGACAGGCGTGCACATGCTCCAAAGAGCCAGCTACAACCCATCAAGAATATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAT

Visual representation of DNA barcode sequence for Giant Puffball Mushroom

Leave a Reply

Your email address will not be published. Required fields are marked *