131/150: What has a lion’s mane and lives under the sea? A jellyfish!
Animalia: Cnidaria: Scyphozoa: Semaeostomeae: Cyaneidae: Cyanea: Cyanea capillata (Linnaeus, 1758)
The Lion’s Mane jellyfish is the largest species of jellyfish in the world. The largest specimen was found in 1870 at Massachusetts Bay, United States with a bell diameter of 2.3 meters and tentacles reaching 37 meters, which is longer than the length of a blue whale! These magnificent creatures are known to like cold temperatures and live around northern hemisphere in the north Atlantic, Pacific and Arctic oceans. Due to their large size, certain fish and shrimp species find protection and shelter from their predators by hiding around the jellyfish’s body. As for their diet, the lion’s mane jellyfish’s favourites are zooplankton, moon jellies and ctenophores. They live a pelagic lifestyle, roaming around open seas and often fall to prey to seabirds, ocean sunfish and other jellyfish species. In fact, the leatherback sea turtle feeds almost entirely on this species. Uhm, yum? #Canada150 #Biodiversity150
Here’s the barcode sequence information for this species:
Process ID: CCSMA230-10
nucleotide sequence
AACATTATATTTAATATTTGGTGCTTTTTCAGCCATGATTGGTACAGCTTTTAGTATGATAATAAGATTAGAGCTCTCAGGCCCAGGGTCTATGCTCGGAGACGACCAAATATATAATGTTATAGTAACAGCTCATGCTCTTGTTATGATATTCTTTTTTGTGATGCCCGTGTTGATTGGGGGTTTCGGAAATTGATTTGTCCCACTATATATTGGAAGTCCAGATATGGCTTTCCCTAGACTTAATAACATTAGTTTTTGATTATTACCTCCAGCCCTCCTATTATTATTAGGGTCTTCCTTAATTGAACAAGGAGCTGGAACAGGTTGGACTATTTATCCTCCTCTATCTTCCATACAATTTCATTCTGGGGGGTCAGTAGATATGGCTATATTTAGTTTACATTTAGCTGGTGCTTCCTCTATAATGGGAGCCATAAATTTTATAACAACAATTTTTAACATGAGAGCTCCGGGTATGTCAATGGATAGGTTGCCTCTATTTGTATGGTCAGTACTGGTAACAGCCATTCTTTTACTATTATCCTTACCTGTGTTAGCTGGGGCAATTACAATGTTATTAACAGACAGGAATTTTAANACCTCTTTTTTCGACCCCGCAGGCGGAGGAGACCCAATCTTGTTTCAACACCTATTT
amino acid sequence
TLYLIFGAFSAMIGTAFSMIIRLELSGPGSMLGDDQIYNVIVTAHALVMIFFFVMPVLIGGFGNWFVPLYIGSPDMAFPRLNNISFWLLPPALLLLLGSSLIEQGAGTGWTIYPPLSSIQFHSGGSVDMAIFSLHLAGASSIMGAINFITTIFNMRAPGMSMDRLPLFVWSVLVTAILLLLSLPVLAGAITMLLTDRNFXTSFFDPAGGGDPILFQHLF
Learn more about it’s BIN (Barcode Index Number): BOLD:AAF9673
