#Biodiversity150 number 27 of 150 Amphipod

27/150: The small priceless gems of freshwater ecosystems

Arthropoda: Malacostraca: Amphipoda: Hyalellidae: Hyalella: Hyalella azteca (Saussure, 1858)

Amphipods are common crustaceans that are found in freshwater bodies such as lakes and rivers and Hyalella azteca is one of the most abundant in North America. Due to their small size, these animals mainly feed on diatoms, algae and organic detritus. Though primarily freshwater, these crustaceans can survive in alkaline and brackish waters, and can even extend to tidal pools and lagoons. Despite their small size, these animals are found in large numbers and compose a significant part of the diet of many larger animals such as waterfowls, fish, wading birds, larger invertebrates and small reptiles.  As these animals are key species in various food chains, they are the subject of numerous studies particularly focused on how the effects of climate change can influence the life histories of these organisms. #Canada150 #Biodiversity150

Though this specimen appears in a white colour, Hyalella azteca can also be frequently seen in colours green and brown. Photo Credit: Scott Bauer goo.gl/Ju0gys
In one study, H. azteca were found to be 97% of the diet of white-winged scoters ducks. They must eat a lot of these little amphipods! Photo Credit: Hans Hillewaert goo.gl/juhtLb

 

The original drawing by Georg Ossian Sars of species Epimeria tuberculata in 1893. Hyalella azteca was known as Amphitoe aztecus when first described. goo.gl/nXEu13

Here’s the barcode sequence information for this species:

Process ID:  CRCN060-09

nucleotide sequence

AACCCTATATTTTGTGCTGGGGGCCTGGGCTAGCGCGGTCGGGACTTCTCTCAGAGTGGTCATTCGGTCGGAGCTCAGCAGGCCCGGAAATTTAATCGGAGATGATCAAATTTATAATGTGGTTGTAACTGCACATGCCTTTGTTATAATCTTTTTTATGGTTATGCCTATTATGATCGGGGGGTTCGGCAATTGGCTCGTACCGATTATACTAGGAAGCCCGGATATGGCCTTTCCTCGAATAAACAACATAAGGTTCTGACTTTTGCCTCCTTCTTTAGTACTTCTTTTGATGAGAGGCATAGTAGAGAGGGGGGTAGGGACAGGCTGGACTGTGTACCCTCCGCTATCGGGCAATGTCGCTCACAGAGGGGGGTCAGTCGATATGGCTATTTTTTCATTACATCTGGCAGGTGCGTCTTCGATCTTGGGGGCGATTAATTTTATTTCGACAGTTTTAAATATGCGGACTTCGGGAATAAGAATGGACCGAGTGCCTCTATTTGTTTGGTCTGTGTTTATTACGGCCATTCTTTTATTACTGTCTTTGCCTGTTTTAGCCGGGGCAATCACTATGCTGCTTACTGACCGAAACCTTAACACCTCTTTTTTTGACCCAAGCGGTGGGGGAGACCCCATTTTATACCAACATTTGTTT

amino acid sequence

TLYFVLGAWASAVGTSLSVVIRSELSSPGNLIGDDQIYNVVVTAHAFVMIFFMVMPIMIGGFGNWLVPIMLGSPDMAFPRMNNMSFWLLPPSLVLLLMSGMVESGVGTGWTVYPPLSGNVAHSGGSVDMAIFSLHLAGASSILGAINFISTVLNMRTSGMSMDRVPLFVWSVFITAILLLLSLPVLAGAITMLLTDRNLNTSFFDPSGGGDPILYQHLF

Visual representation of DNA barcode sequence for amphipod

Learn more about it’s BIN (Barcode Index Number): BOLD:ABZ5443

Title Image: Specimen 08BBCRU-060 – Riding Mountain National Park – 15-Aug-2008 -Free Hand
Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics

Leave a Reply

Your email address will not be published. Required fields are marked *