#Biodiversity150 number 42 of 150 Caddisfly

42/150: Nature’s Underwater Architect

Animalia: Arthropoda: Insecta: Trichoptera: Limnephiloidea: Limnephilidae: Philarctus bergrothi (McLachlan, 1880)

Philarctus bergrothi is part of the northern caddisfly family Limnephilidae, which are found within higher elevations in the northern hemisphere. Caddisflies are closely related to moths and butterflies. While moths and butterflies have scales on their wings and bear terrestrial larvae, caddisflies have hairs on their wings and bear aquatic larvae. Inhabiting a variety of aquatic habitats, caddisfly larvae may follow a variety of lifestyles: predacious, herbaceous (leafy plants and algae), or particle collectors (water column and benthos). These larvae have hardened heads but soft bodies and typically create cases, using a variety of abiotic material and saliva, to use as armor. These cases are not only used for protection, but also used by humans as an art form! French artist Hubert Duprat creates artwork by providing wild caddisflies with glamourous stones or precious metals. #Canada150 #Biodiversity150

Philarctus bergrothi shown in a case made with various types of gastropod shells! Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
Philarctus bergrothi without its case, exposing its fleshy and vulnerable body. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
Adult pinned Philarctus bergrothi, exhibiting the distinctive hairy Trichoptera wings. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics

Here’s the barcode sequence information for this species:

Process ID:  EBTCH323-11

nucleotide sequence

ACTATTTACTTTATTTTTGGAATTTGAGCTGGAATAATCGGAACTTCTTTAAGAATAATTATTCGAACTGAATTAGGTACAACTGAATCATTAATTAAAAATGATCAAATTTATAATGTACTAGTTACTGCCCATGCTTTTATTATAATTTTTTTTATGGTAATACCAATCATAATTGGTGGATTCGGTAATTGGCTTGTTCCCCTAATAATCGGTGCACCTGATATAGCTTTCCCTCGTATAAATAACATAAGATTTTGGTTACTACCCCCCTCTTTAAACCTCTTATTAATTAGTGCACTTATTGAAAGAGGAACGGGAACTGGTTGAACAGTATACCCCCCTCTTTCTAGAAACTTAGCTCACGCTGGAAGTTCCGTTGACATCTCCATTTTTTCCCTTCATTTAGCGGGTATTTCTTCAATTTTAGGAGCTATTAACTTTATTTCTACAACACTAAATATACGTAGTAACCTAATAACATTAGACCGAATTCCCCTATTTGTTTGATCAGTAGCTATTACAGCACTTTTACTTCTTCTTTCTTTACCGGTTTTAGCTGGAGCTATTACTATGTTATTAACAGATCGAAATCTAAATACCTCTTTTTTTGACCCCTCAGGGGGGGGTGATCCCATTTTATACCAACATTTATTT

amino acid sequence

TIYFIFGIWAGMIGTSLSMIIRTELGTTESLIKNDQIYNVLVTAHAFIMIFFMVMPIMIGGFGNWLVPLMIGAPDMAFPRMNNMSFWLLPPSLNLLLISALIESGTGTGWTVYPPLSSNLAHAGSSVDISIFSLHLAGISSILGAINFISTTLNMRSNLMTLDRIPLFVWSVAITALLLLLSLPVLAGAITMLLTDRNLNTSFFDPSGGGDPILYQHLF

Visual representation of DNA barcode sequence for Caddisfly

Learn more about it’s BIN (Barcode Index Number): BOLD:AAA2068

Title Image: Specimen BIOUG00928-D02 – Churchill, Manitoba – 11-Jun-2010
Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics

Leave a Reply

Your email address will not be published. Required fields are marked *