animalia: Arthropoda: Insecta: Lepidoptera: Papilionidae: Papilioninae: Papilio: Papilio canadensis (Rothschild & Jordan, 1906)

Commonly known as the Canadian Tiger Swallowtail, Papilio canadensis is one of the most well-known butterflies in Canada because of its large size (wingspan of 7-10 cm) and distinctive pattern (yellow with black tiger stripes). They are found in all provinces with ranges extending to the north of the Arctic Circle in Yukon, Ontario, and Quebec. They are mainly found in open woodlands, northern and evergreen deciduous forests and forest edges, but can even be seen in city backyard gardens. Tiger Swallowtail larvae go through four life stages (instars – egg, immature larva, mature larva, adult), molting and growing an entirely new exoskeleton after each stage, before they pupate (form a cocoon). The immature larvae are brown and white to mimic bird droppings, making them unappealing to predators. The mature larval caterpillar stage is very distinctive with a large green head and body, four yellow dots and two false eyes, serving as camouflage. Fun fact, big eyes are associated with big predators, so these false eyes are meant to deter predators by making the harmless caterpillar look intimidating. They can also raise a brightly coloured and foul smelling forked organ called the osmeterium (‘stink horn’) from behind the head, the sight and smell of which are enough to frighten off many potential predators. Females lay eggs on the underside of leaves of host plants – plants that provide larval food – often birch, black cherries and aspens, which emerge 4-5 days later! There are currently 82 specimens with barcodes on BOLD. #Canada150 #Biodiversity150

Here’s the barcode sequence information for this species:

Process ID:  BBLPA291-10

nucleotide sequence

AACATTATACTTTATTTTTGGAATTTGGGCAAGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCTTTAATATTAGGAGCACCTGATATAGCCTTTCCCCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAACTCTTTTAATTTCAAGAATAATCGTTGAAAGTGGAGCTGGAACTGGATGAACTGTTTACCCCCCTCTTTCCTCTAATATTGCTCATGGAAGAAGATCAGTAGATTTAGTTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCTTTATTATTACTTCTTTCATTACCTGTTTTAGCTGGAGCTATTACAATACTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

amino acid sequence

TLYFIFGIWASMLGTSLSLLIRTELGTPGSLIGDDQIYNTIVTAHAFIMIFFMVMPIMIGGFGNWLVPLMLGAPDMAFPRMNNMSFWLLPPSLTLLISSMIVESGAGTGWTVYPPLSSNIAHGSSSVDLVIFSLHLAGISSILGAINFITTIINMRINNMSFDQMPLFVWAVGITALLLLLSLPVLAGAITMLLTDRNLNTSFFDPAGGGDPILYQHLF

Learn more about it’s BIN (Barcode Index Number): BOLD:ACE3135

Title Image: Specimen 10BBCLP-0291 – Prince Albert National Park, Saskatchewan – 18-Jun-2010 -Free Hand
Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics