46/150: Earthworms – Westward Ho!
animalia: Annelida: Clitellata: Haplotaxida: Lumbricidae: Dendrobaena: Dendrobaena octaedra (Savigny, 1826)
Happy Earth Day! Let’s talk about earthworms! Although they are found in many gardens and forests in Canada today, earthworms such as Dendrobaena octaedra are not actually native to this country. In fact, their movement and establishment to North America can be traced to early settlers from Europe, who may have either brought worms for agricultural benefits or accidentally in ship ballasts. Before this, Canadian forests were free of earthworms, and the continuing Western expansions of species that dwell in the soil and leaf litter are a detriment to these habitats. D. octaedra and other earthworms consume the layer of decomposing organic matter and mix soil layers in these forests which can reduce numbers of small invertebrates found in those soils and can disrupt the growth of saplings. There are currently 246 specimens of D. octaedra with barcodes on BOLD. #Canada150 #Biodiversity150
Here’s the barcode sequence information for this species:
Process ID: ECANN019-09
nucleotide sequence
AACCTTATATTTTATCTTGGGCATTTGAGCTGGAATAGTAGGAGCAGGCATAAGATTATTAATCCGAATTGAACTAAGCCAACCCGGAGCATTTCTAGGAAGAGATCAACTATATAACACTATCGTAACAGCCCACGCATTTGTTATAATTTTCTTTTTAGTAATACCCGTATTTATTGGAGGATTTGGAAACTGACTCCTTCCTCTCATACTAGGAGCACCTGACATAGCCTTTCCTCGACTAAATAATATAAGGTTTTGACTATTACCCCCATCCCTAATTCTTCTTGTATCCTCCGCAGCTGTAGAGAAGGGAGCGGGAACGGGTTGAACAGTATACCCACCTCTTGCAAGAAACTTGGCTCATGCTGGGCCATCAGTAGACTTAGCTATTTTCTCCCTTCACTTAGCTGGAGCCTCTTCAATTTTAGGTGCAATTAATTTTATTACTACAGTTATCAATATACGATGATCGGGACTACGACTAGAGCGAATTCCCCTATTTGTCTGAGCTGTACTAATTACAGTTATTCTACTTCTCCTGTCACTGCCTGTATTAGCCGGGGCAATTACTATACTTTTAACAGACCGAAATTTAAATACATCATTTTTTGATCCTGCGGGAGGGGGTGATCCAATTTTATACCAACACCTTTTT
amino acid sequence
TLYFILGIWAGMVGAGMSLLIRIELSQPGAFLGSDQLYNTIVTAHAFVMIFFLVMPVFIGGFGNWLLPLMLGAPDMAFPRLNNMSFWLLPPSLILLVSSAAVEKGAGTGWTVYPPLASNLAHAGPSVDLAIFSLHLAGASSILGAINFITTVINMRWSGLRLERIPLFVWAVLITVILLLLSLPVLAGAITMLLTDRNLNTSFFDPAGGGDPILYQHLF
Learn more about it’s BIN (Barcode Index Number): BOLD:ABZ5406