#Biodiversity150 number 46 of 150 earthworm

46/150: Earthworms – Westward Ho!

Annelida: Clitellata: Haplotaxida: Lumbricidae: Dendrobaena: Dendrobaena octaedra (Savigny, 1826)

Happy Earth Day! Let’s talk about earthworms! Although they are found in many gardens and forests in Canada today, earthworms such as Dendrobaena octaedra are not actually native to this country. In fact, their movement and establishment to North America can be traced to early settlers from Europe, who may have either brought worms for agricultural benefits or accidentally in ship ballasts. Before this, Canadian forests were free of earthworms, and the continuing Western expansions of species that dwell in the soil and leaf litter are a detriment to these habitats. D. octaedra and other earthworms consume the layer of decomposing organic matter and mix soil layers in these forests which can reduce numbers of small invertebrates found in those soils and can disrupt the growth of saplings. There are currently 246 specimens of D. octaedra with barcodes on BOLD. #Canada150 #Biodiversity150

Specimen 09BBANN-074 – Kejimkujik National Park – 01-Aug-2009. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
Earthworm head anatomy, showing the relative complexity of an organism we consider quite simple. Photo Credit: KDS4444 goo.gl/AatnJM
Cocoons of Lumbricus terrestris, another invasive earthworm, which are commonly found in leaf litter, can be trapped in vehicle tires, which expedite their movement. Photo Credit: Clive A. Edwards, Ohio State University goo.gl/nG1lij

Here’s the barcode sequence information for this species:

Process ID:  ECANN019-09

nucleotide sequence

AACCTTATATTTTATCTTGGGCATTTGAGCTGGAATAGTAGGAGCAGGCATAAGATTATTAATCCGAATTGAACTAAGCCAACCCGGAGCATTTCTAGGAAGAGATCAACTATATAACACTATCGTAACAGCCCACGCATTTGTTATAATTTTCTTTTTAGTAATACCCGTATTTATTGGAGGATTTGGAAACTGACTCCTTCCTCTCATACTAGGAGCACCTGACATAGCCTTTCCTCGACTAAATAATATAAGGTTTTGACTATTACCCCCATCCCTAATTCTTCTTGTATCCTCCGCAGCTGTAGAGAAGGGAGCGGGAACGGGTTGAACAGTATACCCACCTCTTGCAAGAAACTTGGCTCATGCTGGGCCATCAGTAGACTTAGCTATTTTCTCCCTTCACTTAGCTGGAGCCTCTTCAATTTTAGGTGCAATTAATTTTATTACTACAGTTATCAATATACGATGATCGGGACTACGACTAGAGCGAATTCCCCTATTTGTCTGAGCTGTACTAATTACAGTTATTCTACTTCTCCTGTCACTGCCTGTATTAGCCGGGGCAATTACTATACTTTTAACAGACCGAAATTTAAATACATCATTTTTTGATCCTGCGGGAGGGGGTGATCCAATTTTATACCAACACCTTTTT

amino acid sequence

TLYFILGIWAGMVGAGMSLLIRIELSQPGAFLGSDQLYNTIVTAHAFVMIFFLVMPVFIGGFGNWLLPLMLGAPDMAFPRLNNMSFWLLPPSLILLVSSAAVEKGAGTGWTVYPPLASNLAHAGPSVDLAIFSLHLAGASSILGAINFITTVINMRWSGLRLERIPLFVWAVLITVILLLLSLPVLAGAITMLLTDRNLNTSFFDPAGGGDPILYQHLF

Visual representation of DNA barcode sequence for earthworm

Learn more about it’s BIN (Barcode Index Number): BOLD:ABZ5406

Leave a Reply

Your email address will not be published. Required fields are marked *