#Biodiversity150 number 61 of 150 Harvester Butterfly

61/150: Some caterpillars love to eat insects!

Arthropoda: Insecta: Lepidoptera: Lycaenidae: Miletinae: Feniseca: Feniseca tarquinius (Fabricius, 1793)

When thinking of a typical caterpillar, you may picture one happily munching away on leaves. Not all caterpillars, however, feed on plants. The caterpillars of the harvester butterfly (Feniseca tarquinius) are actually insectivorous, meaning they feed on insects. This is the only species of butterfly in North America that feeds this way. They typically eat aphids or other true bugs such as scale insects. The female butterflies purposefully lay their eggs in or near colonies of aphids so that when the eggs hatch the caterpillars are right at their food source. To protect themselves from predators, such as ants, the caterpillars will often cover themselves in the carcasses of the aphids they have eaten. There are 162 barcodes for the harvester on BOLD. #Canada150 #Biodiversity150

Specimen CCDB-24279-H03 – Carleton County, Ontario – 7-May-2012. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
A look at the underside of the wings of the Harvester butterfly. Photo Credit: Benny Mazur goo.gl/Qzutka
Another Harvester butterfly from Virginia, United States. Photo Credit: Judy Gallagher goo.gl/XMV5Ux

Here’s the barcode sequence information for this species:

Process ID:  CNCBF1037-14

nucleotide sequence

AACTTTATACTTTATCTTCGGTATTTGAGCAGGTATATTGGGTACCTCCTTGAGCATCTTAATCCGTTTAGAATTAAGAACTCCTAACTCTCTTATTGGAAATGATCAAATTTATAACACTATTGTTACAGCACATGCTTTTATTATAATTTTCTTTATAGTTATGCCCATTATAATTGGAGGATTTGGAAACTGATTAGTTCCCTTAATACTGGGATCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTCTCCCTCCCTCCCTATTACTATTAATTTCAAGAAGAATTGTTGAAAATGGGGCTGGAACCGGTTGAACTGTATATCCACCCCTATCTTCCAATATTGCTCATAATGGAGCTTCAGTTGACTTAGCCATTTTCTCTTTACATTTAGCCGGAATTTCATCAATTTTAGGGGCTATTAACTTTATTACAACTATTATTAACATACGAATTAATAACTTATCATTTGATAAATTATCCTTATTTATTTGAGCAGTAGGGATTACGGCCCTTCTTCTACTTTTATCTCTTCCTGTTTTAGCAGGAGCTATTACTATATTGTTAACTGACCGAAACTTAAATACATCCTTTTTTGATCCTTCAGGAGGAGGTGACCCAATTTTATATCAACATTTATTC

amino acid sequence

TLYFIFGIWAGMLGTSLSILIRLELSTPNSLIGNDQIYNTIVTAHAFIMIFFMVMPIMIGGFGNWLVPLMLGSPDMAFPRMNNMSFWLLPPSLLLLISSSIVENGAGTGWTVYPPLSSNIAHNGASVDLAIFSLHLAGISSILGAINFITTIINMRINNLSFDKLSLFIWAVGITALLLLLSLPVLAGAITMLLTDRNLNTSFFDPSGGGDPILYQHLF

Visual representation of DNA barcode sequence for Harvester Butterfly

Learn more about it’s BIN (Barcode Index Number): BOLD:AAJ0404

Leave a Reply

Your email address will not be published. Required fields are marked *