#Biodiversity150 number 4 of 150 Yellow Cedar Tree

6/150: Yellow cedars get cold feet

Plantae: Pinophyta: Pinidae: Pinales: Cupressaceae: Callitropsis: Callitropsis nootkatensis (D. Don, 1824)

One of the oldest known trees in Canada is a Yellow Cedar (Callitropsis nootkatensis), and its estimated age is over 1800 years! Unfortunately the tree was discovered after having been cut down in a clear cut operation in 1980. The species is named after First Nations Nuu-chah-nulth  (Nootka) tribe of Vancouver Island where it was first recorded, however it can be found all along the west coast of North America from Northern California to Alaska. The tree can grow to over 40 meters and is highly valued for its rot-resistant and uniform timber and had many uses in Aboriginal culture. In recent years, C. nootkatensis have been dying out on a large scale raising concern. Scientists have determined this is a result of root freezing which eventually causes the entire tree to die. The shallow root system is usually protected by snow which acts as an insulator but due to recent reductions in snow levels the roots are vulnerable to freezing. Efforts are now being made to conserve this culturally and economically important tree in a changing climate. #Canada150 #Biodiversity150

Synonyms: Chamaecyparis nootkatensisXanthocyparis nootkatensis, Cupressus nootkatensis

Other names: Alaska cedar and Nootka cypress

Live Yellow Cedar tree in Mount Baker-Snoqualmie National Forest, Washington, USA. Photo Credit: Walter Siegmund goo.gl/Ad8sy7
Range and Decline map of Yellow Cedar. Photo Credit: Tongass National Forest District goo.gl/E9f33W

Here’s the barcode sequence information for this species:

Process ID: VASCB025-15

nucleotide sequence

TGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTCGGCCAAGGGCACGTCTGCTTGGGCGTCGCACTCCAAGTTCGCCCTCCCTGGCGGAGGAGCGTAGATGGCCGTCCGTGTCCGATTGTGGTGCGGTCGGCTGAAATGAGCACGAGGTCCGTCGATCTGTCGCGACGAGCGGTGGCCTATGAAGGTCGGCGTTGGTTTGTGCAGTTCGAGCGAGGCCGAGTGTGGAACTTTAAATTGGCCACAGCGGCCTGCCATAGTGCGGGCATGTTGGGCCCCTTCCGCGTCCCCAAGTCAGGCGTGAATACCCGCTGAGTTTAA————————————————————

Title Image: Specimen CCDB-23395-C08 – Penticton, British Columbia – 01-Aug-1975
Photo Credit: Agriculture and Agrifood Canada

Leave a Reply

Your email address will not be published. Required fields are marked *