#Biodiversity150 number 62 of 150 Pseudoscorpion

62/150: I can live in the dirt or in your home, I hitch-hike on insects and mammals alike, and have venomous pincers. What am I?

Animalia: Arthropoda: Arachnida: Pseudoscorpiones: Neobisiidae: Microbisium: Microbisium parvulum (Banks,1895)

Pseudoscorpions are rarely seen but are common arachnids that resemble tiny scorpions with their two large pincers and 8 legs. Unlike scorpions, they are 3 mm in size with no stinger. Using venom glands located on the mobile finger of their pincers they prey upon booklice, ants, mites and small flies. They find their prey in a variety of habitats such as in leaf litter, soil, under stones on the seashore or in homes, especially in rooms with old, dusty books. Mothers will carry their fertilized eggs in a brood pouch attached to her abdomen while recently hatched individuals will hitch a ride on their mother. Some species of pseudoscorpions continue to hitch-hike as adults, catching rides with beetles, flies and even bats. Pseudoscorpions are distributed worldwide across tropical to temperate to cold regions like in Northern Ontario (local species, Microbisium parvulum). There are 11 specimens representing species M. parvulum on BOLD with barcodes. #Canada150 #Biodiversity150

Pseudoscorpion enjoying a yummy meal of a booklice. Photo Credit: Brenda Dobbs goo.gl/T6CNCI
Pseudoscorpion hitching a ride on a fly. Photo Credit: Sarefo goo.gl/MYTBrd

Here’s the barcode sequence information for this species:

Process ID:  RRBFA432-15

nucleotide sequence

ACCTTATATTTAATTTTTGGTGTATGATCTGGTATTATAGGTATAAGTTTAAGAATAATTATTCGATTACAAATAATAATACCTGGAATATTAATTTCTGATCATAATTATAATGTTGTTGTGACAACTCATGCTTTTATTATAATTTTTTTTATAATTATACCTATAATAATTGGAGGATTTGGAAACTGATTAGTTCCTCTAATAATCGGTTCTCCTGATATAGCTTTTCCGCGAATGAATAATTTAAGATTTTGACTTTTACCCCCATCTTTAAGAATGTTGATTTTATCTTCTACTCTTGAAATAGGTTCTGGGACTGGATGAACTATTTATCCTCCTTTAGCTAGTAATGTATTTCATCCTGGAAAATCTATAGATTTATTAATTTTTTCTTTACATTTAGCTGGAGTATCTTCTATTTTAGGGGCTGTAAATTTTATTTCAACTATTATAAATATACGAATACCAGCAATAAAATTGAAAATAATACCTTTATTTGTTTGATCTATTTTCTTTACTACAATTTTGCTTCTTTTAGCTATTCCTGTATTGGCAGGAGCCATTACAATA—————————————————————

amino acid sequence

TLYLIFGVWSGIMGMSLSMIIRLQMMMPGMLISDHNYNVVVTTHAFIMIFFMIMPMMIGGFGNWLVPLMIGSPDMAFPRMNNLSFWLLPPSLSMLILSSTLEMGSGTGWTIYPPLASNVFHPGKSMDLLIFSLHLAGVSSILGAVNFISTIMNMRMPAMKLKMMPLFVWSIFFTTILLLLAIPVLAGAITM———————

Visual representation of DNA barcode sequence for Pseudoscorpion

Learn more about it’s BIN (Barcode Index Number): BOLD:AAB2508

Title Image: Specimen BIOUG21887-F10 – rare Charitable Research Reserve, Cambridge, Ontario – 01-May-2015 – Berlese Funnel
Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics

Leave a Reply

Your email address will not be published. Required fields are marked *