#Biodiversity150 number 66 of 150 Hairy waterclover

66/150: Well, that is just dumb luck

Plantae: Pteridophyta: Pteridopsida: Hydropteridales: Marsileaceae: Marsilea vestita (Linnaeus)

Don’t be fooled, Hairy waterclover (Marsilea vestita) may LOOK like something that could give you a lifetime of good luck, but in reality are just four-leaf clover wannabes. Hairy waterclover, also known as Hairy pepperwort, is a type of aquatic fern that you can find in damp areas such as vernal pools, ponds and muddy banks. So what is the difference between our lucky clover and Marsilea vestita, you may ask? Well, whereas clovers have flowers to help with reproduction, waterclover instead develops hairy spore cases that release spores when water levels are low. These spore cases resemble peppercorns, giving the waterclovers their clever nickname! Spore cases contain male spores (microspores) and female spores (megaspores) which eventually germinate into small male and female plants. These tiny male and female plants produce sperm and eggs, which then combine during the fertilization process. The end result of this reproductive process is a young waterclover plant, which will never be able to live up to its distant relative’s name. Now that is REALLY dumb luck. #Canada150 #Biodiversity150

Specimen CCDB-23363-E08 – Saskatchewan, Canada – 18-Sept-1990. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
A group of ‘lucky’ Hairy waterclovers. Escalante, Hole-in-the-Rock, Utah – 17-April-2006 Photo Credit: Jason Hollinger goo.gl/JzRS0A
Hawaiian waterfern, a close relative to the Hairy waterclover, also often mistaken for the shamrock. Photo Credit: David Elckhoff goo.gl/mP2U2F

Here’s the barcode sequence information for this species:

Process ID:  PCCMN435-14

nucleotide sequence

GCGCCCGAGGCTCGTCCGAGGGCACGTCTGCCTGAGCGTCCACTTCACCCCCTCGCCCGACCCTCCTCGCGGGAGTCGGGCGGAGTTGGTCGTCCGTCCTCGTCTCGCCCCTACGTTCCTGCGGGAGTTCGGGGGGCGACGACGGAGAGCGGTCGGCTCAAATTCATCGATTGCGCTTTTCGCGGACGGGTGCTGCACGGGTGATTCTGTTCCCGGACGAACCTCGTTCGGCCGGGGCGGCTCTGCGGCCTCCGTCTCGCTGGCGCGCGTGTCGAAACGAAACGGGCTCCGTGCTCGGGACGCGTGGGGCTCGCTCCTCCTC

Visual representation of DNA barcode sequence for Hairy Waterclover

Leave a Reply

Your email address will not be published. Required fields are marked *