#Biodiversity150 number 77 of 150 Mapleleaf mussel

77/150: Mapleleaf Mussel – Important environmental indicators of Canadian Rivers and Lakes

Animalia: Mollusca: Bivalvia: Unionoida: Unionidae: Ambleminae: Quadrula: Quadrula quadrula (Rafinesque, 1820)

The Mapleleaf mussel is a freshwater mussel found in North America. Mapleleaf mussels are a threatened species in Ontario since 2008 and have completely disappeared from Lake Erie, Detroit and Niagara rivers. The main threats to this species are habitat destruction, invasive Zebra mussels from Europe and any conditions which threaten their host fish, the Channel Catfish. Mapleleaf mussels undergo a complex lifecycle which includes a parasitic phase of juvenile mussels. The mother Mapleleaf mussel presents a lure which gives her the appearance of being dead. Dead mussels being a favourite food of the Channel Catfish, entices the fish to take a bite while the mussel releases her larvae, allowing them to attach to the gills and absorb nutrients as they grow. As adults they have average life spans of 22 years and are important indicators of environmental health due to their complex lifestyles. There are five Mapleleaf mussels with barcodes on BOLD. #Canada150 #Biodiversity150

Specimen NIMUS820-15 – Sydenham River, Dawn Mills, Chatham-Kent, Ontario – 27-July-2015. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
Mapleleaf Mussel mother, displaying her lure to deposit her larvae in the Catfish’s gills. Photo Credit: U.S. Fishing and Wildlife Service Southeast Region goo.gl/pBM9Aj
Juvenile Mapleleaf Mussels. Notice how tiny they are! Photo Credit: USFWS Fish and Aquatic Conservation goo.gl/tBEvWJ
The Channel Catfish, the mussel’s host fish. Photo Credit: U.S. Army Corps of Engineers goo.gl/7PN5qe

Here’s the barcode sequence information for this species:

Process ID:

nucleotide sequence

AACTTTATATTTGTTGCTGGCTTTGTGGTCTGGTTTAATTGGGTTGGCTTTGAGGCTTTTGATTCGGGCTGAGTTGGGGCAACCTGGTAGATTATTGGGAGATGATCAGTTGTATAATGTGATTGTGACGGCTCATGCTTTTATGATGATCTTTTTTTTGGTGATGCCAATGATAATTGGTGGTTTTGGTAATTGACTTATCCCACTTATGATTGGGGCTCCGGATATGGCTTTTCCTCGGTTAAATAATCTTAGTTTTTGGTTGCTTGTGCCAGCTCTTTTTTTGTTATTAAGATCTTCTATGGTAGAAAGGGGTGTTGGGACTGGTTGGACGGTTTATCCTCCGTTGTCTGGGAATATTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATCTTTTCTTTGCATCTTGCGGGAGCATCTTCTATTTTGGGGGCTATTAATTTTATTTCTACTGTTGGTAACATGCGGTCTCCTGGGTTGGTGGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTACAGTAACAGCAGTTTTATTGGTTGCGGCGTTACCTGTTTTAGCTGGTGCTATCACGATGCTACTTACGGATCGTAATATTAATACATCTTTTTTTGACCCTGTTGGGGGAGGTGATCCTATTTTGTATATGCA—————

amino acid sequence

TLYLLLALWSGLIGLALSLLIRAELGQPGSLLGDDQLYNVIVTAHAFMMIFFLVMPMMIGGFGNWLIPLMIGAPDMAFPRLNNLSFWLLVPALFLLLSSSMVESGVGTGWTVYPPLSGNIAHSGASVDLAIFSLHLAGASSILGAINFISTVGNMRSPGLVAERIPLFVWAVTVTAVLLVAALPVLAGAITMLLTDRNINTSFFDPVGGGDPILYMX—–

Visual representation of DNA barcode sequence for Mapleaf mussel

Learn more about it’s BIN (Barcode Index Number): BOLD:AAE7541

Leave a Reply

Your email address will not be published. Required fields are marked *