127/150: Happy Halloween! The Masked Hunter wears a costume of disguise!

Animalia: Arthropoda: Insecta: Hemiptera: Reduviidae: Reduviinae: Reduvius: Reduvius personatus (Linnaeus, 1758)

The Masked Hunter is a true bug belonging to the family Reduviidae, also known as the Assassin Bugs. In accordance to their dangerous sounding common name they are known to have a painful bite, but they are relatively harmless towards humans as they don’t feed on blood or transmit diseases. The nymphs of this species are very interesting because they exude a sticky substance from “head to toe” allowing them to collect dust, lint and other particles. This natural camouflage enables them to ambush their unsuspecting prey. The next time you see a dust bunny floating around your house take a closer look as it may be a Masked Hunter in disguise! #Canada150 #Biodiversity150 #Halloween

Specimen CNC#HEM300372 – Osoyoos, British Columbia – 20-Jun-2005. Photo Credit: CNC/BIO Photography Group, Centre for Biodiversity Genomics
A Masked Hunter nymph covered in sand as its costume for Halloween! Photo Credit: Chiswick Chap goo.gl/6FKrhN
Close-up view of the Masked Hunters piercing mouthparts. Photo Credit: Thomas Pieper goo.gl/H5PXkw

Here’s the barcode sequence information for this species:

Process ID: HMCN586-09

nucleotide sequence

AACTCTTTATTTTCTCTTCGGTGGCTGGGCAGGTATAGTAGGAACATCGCTCAGATGATTAATTCGAATTGAATTAGGACAACCAGGATCCTTCATCGGTGATGACCAAACATATAATGTTATAGTTACTGCACATGCATTCATTATGATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGGAACTGATTAGTACCCTTAATGATTGGGGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCCCCATCTCTCACTCTCTTAATTATAAGAAGTATTGTAGAAACAGGGGCAGGAACAGGATGAACCGTTTACCCCCCTCTATCAAGAAATATGAGACATGCAGGTGCATCCGTTGACCTTGCAATTTTTTCTCTTCACCTAGCAGGGATTTCATCAATCTTAGGAGCAATAAATTTTATTTCAACCATCATCAATATACGAACCGCGGGAATAACCCCCGAACGGATCCCTCTTTTTGTTTGATCAGTTGGTATTACTGCACTTCTCCTACTTCTCTCTTTACCTGTCCTAGCAGGAGCAATTACTATACTCCTAACAGATCGAAACTTTAATACAAGATTTTTTGACCCAGCTGGAGGGGGGGATCCTATTTTATATCAACATTTATTT

amino acid sequence

TLYFLFGGWAGMVGTSLSWLIRIELGQPGSFIGDDQTYNVMVTAHAFIMIFFMVMPIMIGGFGNWLVPLMIGAPDMAFPRMNNMSFWLLPPSLTLLIMSSIVETGAGTGWTVYPPLSSNMSHAGASVDLAIFSLHLAGISSILGAMNFISTIINMRTAGMTPERIPLFVWSVGITALLLLLSLPVLAGAITMLLTDRNFNTSFFDPAGGGDPILYQHLF

Visual representation of DNA barcode sequence for Masked Hunter Bug

Learn more about it’s BIN (Barcode Index Number): BOLD:AAH2979

48/150: Talk about using your nose!

Animalia: Chordata: Mammalia: Eulipotyphla: Talpidae: Scalopinae: Condylura cristata (Linnaeus, 1758)

Moles belong to the family Talpidae which are known for their burrowing behaviours. The star-nosed mole is interestingly distinguishable from all other moles due to a ring of tentacle-like organs surrounding the snout. These fleshy appendages form the star-shaped Eimer’s organs. Continue reading “48/150: Talk about using your nose!”

18/150: A fungus beetle known for using its head

Animalia: Arthropoda: Insecta: Coleoptera: Tenebrionidae: Bolitotherus: Bolitotherus cornutus (Panzer, 1794)

Male Bolitotherus cornutus, commonly known as the Forked Fungus beetle, have fork-like horns in which they use to compete for mates. Those with bigger horns have better success at prying rivals off of their prized females. Continue reading “18/150: A fungus beetle known for using its head”

1/150: These Fireflies are Wolves in Sheep’s Clothing

Animalia: Arthropoda: Insecta: Coleoptera: Lampyridae: Photuris quadrifulgens (Barber, 1951)

Photuris quadrifulgens is a species in the beetle family Lampyridae, commonly known as the fireflies. This species belongs to the femme fatale lightning bugs that produce light flashes from lantern organs on their abdomen. Continue reading “1/150: These Fireflies are Wolves in Sheep’s Clothing”