149/150: Not your typical song scales

Animalia: Arthropoda: Insecta: Hemiptera: Sternorrhynncha: Coccoidea: Diaspididae: Quadraspidiotus: Quadraspidiotus perniciosus (Comstock, 1881)

Scale bugs are some pesky critters. Belonging to the order Hemiptera, they have a defining beak like characteristic used to suck out the contents of its prey. The females are typically immobile and have a waxy scale like surface whereas the males have one set of functioning forewings and suppressed hindwings. Continue reading “149/150: Not your typical song scales”

135/150: This tiny mite can cause massive damage!

Animalia: Arthropoda: Arachnida: Trombidiformes: Tetranycinae: Tetranychinae: Tetranychus: Tetranychus urticae (C. L. Kock, 1836)

The two-spotted spider mite is of economic importance as it is a common pest worldwide.  It has been found to feed on more than 1,100 different species of plants! Including important crops such as maize, soy, citrus, apples, tomatoes, strawberries, and peppers. By sucking the cell contents from leaves, the mite leaves small lesions that in large numbers will reduce the photosynthetic capabilities of plants. It is highly resistant to pesticides so researchers sequenced its entire genome in 2011 to understand its biology to create more effective pesticides.

These mites are barely visible to the naked eye at 0.4 mm long and comes in many colours including brown, orange, and green. It is named for the two spots located symmetrically on each side of its back. These spots are actually the buildup of body waste that can be seen through the mite’s transparent body wall. Like all spider mites, the two-spotted variety can spin fine strands of web. #Canada150 #Biodiversity150

Specimen BIOUG08419-E08 – Wellington County, Guelph, Ontario, Canada – 30-May-2013. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
Web of the spider mite Tetranycus urticae. Photo Credit: University of Florida goo.gl/6jokcW
Colorized scanning electron microscope image of Tetranychus urticae. Photo Credit: Eric Erbe and Chris Pooley goo.gl/6jokcW
Eggs of the spider mite Tetranychus urticae. Photo Credit: Gilles San Martin goo.gl/65c6Cm

Here’s the barcode sequence information for this species:

Process ID: MBIOC060-13

nucleotide sequence

AACTATGTATTTTTTATTTAGATTATTTTCAGGACTTATAGGGACTTCAATAAGAATTATTATTCGATTAGAACTTATAACACCAGGATCATTAATTCAAAATGATTTTATTTATAATTCAATAGTTACAACGCACGCTATAATTATAATTTTTTTTATAGTTATACCAGCTATAATTGGAGGATTTGGAAATTGATTGATTCCTTTAATAATTAATACTGTAGATTTATGTTTTCCGCGAATTAATAATATAAGATTTTGATTGCTAATTCCTTCTTTAATATTAATAATTTCTTCATCCATAAAAAGTGTTTTAAATGGAGTGGGTTGAACAATATATCCCCCCCTAACTTCAATTCAATATTTTATGTCTTCCTCTATTGAAATAATAATTTTTTCTTTACATATTGCAGGAATTTCTTCAATTGCTAGATCTATTAATTTTATTTCAACTATTCTATTAATAAAAAATAAAAATTATTTTTTAAGAAATTTAACTTTATTTTCTTTATCAATTTTAATTACTACATTTTTACTTTTATTAGCATTACCTGTCTTAGCAGGAGCAATTACAATAATTTTAATAGATCGAAATTTTAATACATCATTTTTTGATCCAAGAGGAGGAGGAGACCCAATTTTATATCAACATTTATTT

amino acid sequence

TMYFLFSLFSGLMGTSMSIIIRLELMTPGSLIQNDFIYNSMVTTHAMIMIFFMVMPAMIGGFGNWLIPLMINTVDLCFPRINNMSFWLLIPSLMLMISSSMKSVLNGVGWTMYPPLTSIQYFMSSSIEMMIFSLHIAGISSIASSINFISTILLMKNKNYFLSNLTLFSLSILITTFLLLLALPVLAGAITMILMDRNFNTSFFDPSGGGDPILYQHL

Visual representation of DNA barcode sequence for Two-spotted spider mite

Learn more about it’s BIN (Barcode Index Number): BOLD:ABY3244

111/150: See no Weevil, Hear no Weevil, Speak no Weevil

Animalia: Arthropoda: Insecta: Coleoptera: Curculionidae: Otiorhynchus: Otiorhynchus sulcatus (Fabricius, 1775)

Not all weevils are evil, but unfortunately this species of weevil is quite a pest. The black vine weevil has been found to be a pest of over 100 different wild and cultivated plants. Unfortunately, this species is not the lesser of two evils since its larval and adult stage are both considered pests. Continue reading “111/150: See no Weevil, Hear no Weevil, Speak no Weevil”

106/150: Thrips are tiny insects with big agricultural implications

Animalia: Arthropoda: Insecta: Thysanoptera: Thripidae: Thripinae: Frankliniella: Frankliniella occidentalis (Pergande, 1895)

Western flower thrips belong to the order Thysanoptera. These insects are very small (~1mm long) and elongated with long thin wings fringed with hairs. Like true bugs, they have small piercing and sucking mouthparts on the underside for feeding on plant tissue. Continue reading “106/150: Thrips are tiny insects with big agricultural implications”

58/150: Using flying snakes to combat agricultural pests? –The family Raphidiidae

Animalia: Arthropoda: Insecta: Raphidioptera: Raphidiidae: Agulla: Agulla adnixa (Hagen, 1861)

Fear not, these little arthropods have the potential to keep our crops healthy! The family Raphidiidae, snake flies, are closely related to the “nerve winged” insects (Neuroptera) including lacewings and antlions. Continue reading “58/150: Using flying snakes to combat agricultural pests? –The family Raphidiidae”

39/150: Are they centipedes or….??

animalia: Arthropoda: Symphyla: Symphyla order incertae sedis: Scolopendrellidae

Also known as symphylans or garden centipedes, pseudocentipedes are only distant relatives of true centipedes! They are actually more closely related to pauropods and millipedes of the same subphylum Myriapoda. Continue reading “39/150: Are they centipedes or….??”

25/150: World Wildlife Day – Even though we are microscopic we are still wildlife!

animalia: Arthropoda: Arachnida: Mesostigmata: Phytoseiidae: Typhlodromus: Typhlodromus pyri (Scheuten, 1857)

The predatory plant mite Typhlodromus pyri is just one of thousands of species belonging to the family Phytoseiidae (Order: Mesostigmata). While mesostigs encompass a number of predators, parasites, and plant feeders, the Phytoseiidae are mainly predators of other small invertebrates, but some also eat pollen and fungi. Continue reading “25/150: World Wildlife Day – Even though we are microscopic we are still wildlife!”