128/150: The amazingly acrobatic eyed click beetle!

Animalia: Arthropoda: Insecta: Coleoptera: Elateridae: Agrypninae: Alaus: Alaus oculatus (Linnaeus, 1758)

Alaus oculatus belongs to the family Elateridae, a group commonly known as click beetles. These insects get their name from the unique clicking mechanism they all share. When one of these beetles finds itself upside down, it will arch so only the tip of its head and abdomen touch the ground, then quickly straighten itself. As it does this, a spine on their underside snaps into a groove on the thorax, launching the beetle into a flip and causing the distinctive clicking noise.

The eyed click beetle can be found throughout the deciduous forests and woodlands of North and Central America. The beetles are named for the spots on their back, which are commonly believed to ward off predators. While the adults of this species feed only on nectar, the larvae are carnivorous, feeding on other beetle larvae they find residing in rotting logs. There are 11 eyed click beetles with barcodes on BOLD. #Canada150 #Biodiversity150

Specimen 10BBCOL-0567 – Texas, United States – 03-Apr-2010 – UV Light Trap. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
An eyed click beetle crawling on a log. Photo Credit: Henry Hartley goo.gl/UxhmBu

Here’s the barcode sequence information for this species:

Process ID: TTCFW882-08

nucleotide sequence

AACCCTTTATTTTCTTTTCGGTGCATGAGCCGGAATACTAGGGACATCACTAAGATTATTGATCCGAGCCGAACTCGGTAATCCTGGATCTCTAATTGGAAATGATCAAATCTATAATGTCGTTGTTACTGCACACGCATTTATCATAATTTTCTTCATAGTTATACCAATTATAATCGGTGGATTCGGAAACTGATTAGTTCCACTTATACTTGGAGCCCCAGATATAGCATTCCCTCGAATGAATAACATAAGATTTTGACTCCTCCCTCCTTCACTATCCCTTCTTCTAATAAGAAGAATTGTAGAAAACGGTGCCGGAACAGGATGAACTGTCTATCCCCCCCTTTCAGCAAACATTGCCCACAGAGGTTCATCAGTTGATTTAGCCATTTTTAGACTGCATCTGGCAGGAATCTCATCAATTCTAGGAGCTGTAAATTTTATTTCTACAGTGATCAATATACGATCAACAGGAATTACCTTTGATCGAATACCTTTATTCGTATGAGCAGTAGCAATTACTGCCCTATTACTACTCCTGTCACTTCCTGTACTAGCAGGAGCAATCACAATATTATTAACAGACCGAAATCTCAACACCACCTTCTTTGATCCCGCAGGAGGAGGAGATCCAATTCTTTATCAACACTTATTT

amino acid sequence

TLYFLFGAWAGMLGTSLSLLIRAELGNPGSLIGNDQIYNVVVTAHAFIMIFFMVMPIMIGGFGNWLVPLMLGAPDMAFPRMNNMSFWLLPPSLSLLLMSSIVENGAGTGWTVYPPLSANIAHSGSSVDLAIFSLHLAGISSILGAVNFISTVINMRSTGITFDRMPLFVWAVAITALLLLLSLPVLAGAITMLLTDRNLNTTFFDPAGGGDPILYQHLF

Visual representation of DNA barcode sequence for Eyed click beetle

Learn more about it’s BIN (Barcode Index Number): BOLD:AAH0252

111/150: See no Weevil, Hear no Weevil, Speak no Weevil

Animalia: Arthropoda: Insecta: Coleoptera: Curculionidae: Otiorhynchus: Otiorhynchus sulcatus (Fabricius, 1775)

Not all weevils are evil, but unfortunately this species of weevil is quite a pest. The black vine weevil has been found to be a pest of over 100 different wild and cultivated plants. Unfortunately, this species is not the lesser of two evils since its larval and adult stage are both considered pests. Continue reading “111/150: See no Weevil, Hear no Weevil, Speak no Weevil”

18/150: A fungus beetle known for using its head

Animalia: Arthropoda: Insecta: Coleoptera: Tenebrionidae: Bolitotherus: Bolitotherus cornutus (Panzer, 1794)

Male Bolitotherus cornutus, commonly known as the Forked Fungus beetle, have fork-like horns in which they use to compete for mates. Those with bigger horns have better success at prying rivals off of their prized females. Continue reading “18/150: A fungus beetle known for using its head”

11/150: Damned by the dam-The Cobblestone Tiger Beetle

animalia: Arthropoda: Insecta: Coleoptera: Carabidae: Cicindelinae: Cicindela: Cicindela marginipennis (DeJean, 1831)

Cobblestone tiger beetles (Cicindela marginipennis) live in small, divided communities in North America, and are endangered in Canada, with an estimated 5,000 individuals remaining. These beetles live in only two areas along the Saint John River in New Brunswick, as they need specialized river habitats with large tree covered islands and sprawling cobblestone beaches to thrive. Continue reading “11/150: Damned by the dam-The Cobblestone Tiger Beetle”

1/150: These Fireflies are Wolves in Sheep’s Clothing

Animalia: Arthropoda: Insecta: Coleoptera: Lampyridae: Photuris quadrifulgens (Barber, 1951)

Photuris quadrifulgens is a species in the beetle family Lampyridae, commonly known as the fireflies. This species belongs to the femme fatale lightning bugs that produce light flashes from lantern organs on their abdomen. Continue reading “1/150: These Fireflies are Wolves in Sheep’s Clothing”

Visiting Victoria

At the end of October, Gerry Blagoev and I flew across the country to visit the Royal British Columbia Museum (RBCM) in Victoria, British Columbia. We were on a quest for specimens! Identified specimens, that is. Most of the time our collections team is busy finding specimens out in the field and preparing them for DNA barcoding. Once they have a sequence, we determine what the taxonomy of our specimen is based on its sequence. But how do we get to the point where we can determine the taxonomy? How do we know this taxonomy is right? By going to the experts! Continue reading “Visiting Victoria”

Busy Barcoding Bees Building Blitzes

Hello again faithful readers,

It’s been a while since I’ve written a blog, and a lot has happened! I’m sure you know all about the 6th Barcode of Life Conference that happened a few weeks ago from the other blogs, but I’ll give you a bit of a refresher. It was busy, crowded with fervent biologists, and a great melting pot of ideas and experiences to advance the state of DNA barcoding all over the world. Continue reading “Busy Barcoding Bees Building Blitzes”

BIObus Sampling At Long Point

Long Point Provincial Park was the next destination for the BIObus’ aquatic sampling tour across Ontario Provincial Parks. Long Point is a sand spit on north shore of Lake Erie, this is a unique region of southern Ontario, being comprised of primarily sandy soils and deciduous trees. The point juts out into Lake Erie, creating a dynamic environment with lots of biodiversity. Continue reading “BIObus Sampling At Long Point”

rare Arthropods

Hello everyone, this past week at BIO, among many other things going on, we finished our standardized sampling at rare Charitable Research Reserve. This was our second sampling event since we had previously sampled the same sites at rare in the late spring. Continue reading “rare Arthropods”

Bark Beetles and Wildfires

Hello again! After taking down all our traps in Burnt Cabin Bog Ecological Reserve, we packed up and drove for two days up to Kluane National Park and Reserve. While the drive was long there was plenty of scenery to see along the way. While driving North on the Stewart-Cassiar highway, we passed through a region of forest where two wildfires had recently occurred, in 2010 and 2011. Continue reading “Bark Beetles and Wildfires”