Animalia: Arthropoda: Protura: Eosentomata: Eosentomidae Berlese, 1909
Look closely, you don’t want to miss them! These proturans are less than 2 mm in length and lack wings, antennae, eyes and pigment; producing an almost see through body. Although they lack some arguably important body parts, they make up for it in other unique ways. They are quadrupeds because their front legs, which are segmented into 5 parts, lost the ability to support their weight and adapted to function as antennae. Furthermore, their bodies are covered in sensory hairs that aid in types of temperature, chemical, humidity and vibrational sensing. Coneheads exhibit anamorphosis, the number of abdominal segments increases with subsequent molts until they reach the adult’s full twelve. Although hard to spot, coneheads can be incredibly numerous in places with moss, leaf litter, decaying wood and temperate forest soils. Their diets are somewhat of a mystery much like the rest of their ecology but have been observed feeding on a mycorrhiza, a fungus that lives on plant roots and fungal hyphae, and in terms of economic importance they are part of the community of decomposers that aid in breaking down and recycling organic nutrients. Overall, there’s more than what meets the eye with these tiny creatures! #Canada150 #Biodiversity150
Here’s the barcode sequence information for this species:
Process ID: SWJNH052-15
nucleotide sequence
AGGCTATATTTCGTTTTTGGGAGGTGATCTGCAATATTAGGTACTTCTTTAAGATTGTTGATTCGTATTGAACTCGGTAGAGCTGGACAATTTCTAGGGAACGACCAGATCTATAATGTAATTGTGACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTTTAATTGGGGGGTTTGGTAATTGGCTAGTCCCATTAATATTAAGGAGCCCTGACATAGCCTTTCCTCGAATAAATAATTTAAGATTCTGGCTTCTTCCTCCTTCTTTATTGTTATTAGTTTTAAGAAGAATTATTGAAATAGGTGTGGGCACGGGGTGGACTGTGTATCCCCCGCTATCTTCCAACTTAGCTCATTTAGGAGTATCTGTAGATCTTGGGATTTTTTCATTACACCTTGCTGGAGCATCTTCTATTCTAGGGGCTATTAATTTTATTACTACTATTGCTAATTCACGAGGGTTTAAGATTAAAATAGAAAATGTTTCATTATTTAGCTGATCTGTATTATTAACTGCAATCTTACTTCTATTGTCTCTTCCTGTTTTAGCCGGTGCCATTACTATACTTTTAACGGATCGTAATATTAATACTTCCTTTTTTGACCCCTTAGGAGGAGGGGACCCTATTTTATTTCAACATCTTTT
amino acid sequence
SLYFVFGSWSAMLGTSLSLLIRIELGSAGQFLGNDQIYNVIVTAHAFIMIFFMVMPILIGGFGNWLVPLMLSSPDMAFPRMNNLSFWLLPPSLLLLVLSSIIEMGVGTGWTVYPPLSSNLAHLGVSVDLGIFSLHLAGASSILGAINFITTIANSRGFKIKMENVSLFSWSVLLTAILLLLSLPVLAGAITMLLTDRNINTSFFDPLGGGDPILFQHLX
Learn more about it’s BIN (Barcode Index Number): BOLD:ACY5591