Animalia: Arthropoda: Insecta: Hemiptera: Lygaeidae: Oncopeltus: Oncopeltus fasciatus: (Dallas, 1852)
Large milkweed bugs are a member of the family Lygaeidae, otherwise known as seed bugs. They get their name from their association with the milkweed plant. They lay their eggs in milkweed pod crevasses and the seeds provide a food and defense source for them. Through eating the seeds, milkweed bugs sequester toxins, which act as a chemical defense against predators. Just like monarch butterflies that also eat milkweed, the large milkweed bug bears the daunting colours of black and orange. This colouration acts as a warning signal for predators to say: “I’m not going to be as tasty as you think.” One interesting misidentification that is commonly made is between these and Box Elder bugs. Despite being the same colour scheme and being roughly the same size, you can tell by the patterns of red on their black wings (seen in the photo below). Those black and orange bugs you seen in the news as pests in large numbers are probably box elder bugs, and not large milkweed bugs. #Canada150 #Biodiversity150
Here’s the barcode sequence information for this species:
Process ID: CRHIA649-16
nucleotide sequence
ATATTTGGAATATGATCTGGAATAGTAGGTTCATCAATAAGATGAATTATTCGAATTGAATTAGGTCAACCAGGTATATTTATTGGAAATGACCAAATTTATAATGTAATTGTAACAGCCCATGCATTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGTGGCTTCGGAAACTGACTAGTACCTTTAATAATTGGAGCACCTGATATAGCATTTCCACGAATAAATAATATAAGATTCTGATTATTACCACCTTCATTAACCCTTCTTTTATCTAGAAGAATTACAGAAAGAGGAGCTGGAACAGGATGAACTGTTTATCCTCCTCTATCTAATAGAATTTTTCACAGAGGAGCATCTGTAGATATGGCTATTTTTTCTCTACATTTAGCAGGAATTTCATCAATTCTGGGTGCAATTAATTTTATTTCAACAATTATTAACATACGACCAACAGGTATGTCTTTAGAAAAAACCCCTTTATTTGTATGATCAGTAGGAATTACAGCTCTATTGCTTCTATTATCCTTACCTGTATTAGCAGGAGCAATCACAATACTATTAACTGAT——————————————————
amino acid sequence
MFGMWSGMVGSSMSWIIRIELGQPGMFIGNDQIYNVIVTAHAFIMIFFMVMPIMIGGFGNWLVPLMIGAPDMAFPRMNNMSFWLLPPSLTLLLSSSITESGAGTGWTVYPPLSNSIFHSGASVDMAIFSLHLAGISSILGAINFISTIINMRPTGMSLEKTPLFVWSVGITALLLLLSLPVLAGAITMLLTD——————
Learn more about it’s BIN (Barcode Index Number): BOLD:AAG8878
