148/150: Learn more about this Canadian rarity

Animalia: Arthropoda: Insecta: Lepidoptera: Geometridae: Larentiinae: Xanthorhoini: Xanthorhoe clarkeata (Douglas Ferguson, 1987)

The Xanthorhoe clarkeata are a newly discovered species of geometrid moth as of 1987. They live primarily on the Haida Gwaii Islands of British Columbia. This species is likely endemic to only these islands, making it a rare and unique species to Canada. Much like most geometrid moths, the females of X. clarkeata are totally wingless! The odd traits don’t end there, the unusual larval form of geometrid moths are known as inchworms. They gain their name from their interesting looping movement pattern thanks to a complete lack of legs in their middle section. Since the caterpillars only have two pairs of rear legs and three pairs of front legs, they anchor their rear legs, extend, and pull their body forward with their front legs giving the appearance of “inching” forward or “measuring” the earth as they walk. The movement of the caterpillars also gives way to their Greek family name: “Geometridae” or “earth measurer”. There are 2,188 geometrid moths with barcodes on BOLD. #Canada150 #Biodiversity150

Specimen CNCLEP00034073 – Graham Island, British Columbia – 27-Jul-1981. Photo Credit: Jeremy deWaard, Centre for Biodiversity Genomics
Specimen CCDB-20269-B09 – Graham Island, British Columbia – 27-Jul-1985. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics

Here’s the barcode sequence information for this species:

Process ID: LNAUS1730-13

nucleotide sequence

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGTTTATTAATTCGAGCCGAATTAGGAAATCCAGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTCATAGTAATACCTATTATAATCGGAGGATTTGGTAATTGATTGGTACCTTTAATGTTAGGGGCCCCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGATTACTACCACCTTCAATTACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACAGTTTATCCCCCTTTATCCTCTAATATTGCTCATGGAGGTAGATCAGTTGATTTAGCTATTTTCTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAACATGCGATTAAATAATATATTTTTTGATCAATTACCTTTATTTGTTTGAGCTGTCGGAATTACAGCATTTTTATTATTACTATCTTTACCAGTTTTAGCTGGGGCTATTACTATATTATTAACAGATCGAAATTTAAATACCTCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTATATCAACATTTATTT

amino acid sequence

TLYFIFGIWAGMIGTSLSLLIRAELGNPGSLIGDDQIYNTIVTAHAFIMIFFMVMPIMIGGFGNWLVPLMLGAPDMAFPRMNNMSFWLLPPSITLLISSSIVENGAGTGWTVYPPLSSNIAHGGSSVDLAIFSLHLAGISSILGAINFITTIINMRLNNMFFDQLPLFVWAVGITAFLLLLSLPVLAGAITMLLTDRNLNTSFFDPAGGGDPILYQHLF

Visual representation of DNA barcode sequence for Xanthorhoe clarkeata

Learn more about it’s BIN (Barcode Index Number): BOLD:AAH9158

14/150: Woolly Bear Caterpillars Surviving Winter

Animalia: Arthropoda: Insecta: Lepidoptera: Lymantriidae: Gynaephora: Gynaephora groenlandica (Homeyer., 1874)

Tired of winter? Get some tips on winter survival from the Arctic Woolly Bear caterpillar (Gynaephora groenlandica). Did you know this caterpillar lives up to 7 (some suggest 14) years before pupating into a moth? Continue reading “14/150: Woolly Bear Caterpillars Surviving Winter”

Catching Moths In The Night

Hey Folks!

Long time no blog. We have been super busy here at BIO in the past few weeks.  Between field work, the rare BioBlitz, and the Barcoding Conference, it has been pretty crazy here lately! There will be lots of blogs coming your way from our staff about all these fun topics.   I myself have been doing a lot of night collecting in the form of Bucket Traps and Night Sheets. Continue reading “Catching Moths In The Night”

Bugs From All Schools Of Study

Hello faithful readers, I’m back! Last you heard, I was returning from a harrowing six week trip on the BIObus to the west coast of Canada, and just recently I returned from the two week field entomology course offered by the University of Guelph. It marked both the final expedition of the course (as far as I am aware) as well as the end of my undergraduate career. My time at school was a load of fun, and I couldn’t have thought of a more fitting culmination. Now, I’m back at BIO and we’re just finishing up the processing for School Malaise. Continue reading “Bugs From All Schools Of Study”

Much Ado About Mothing

Hello there!

My name is Shannon and I am a fifth year Zoology student lucky enough to be part of the team at BIO this summer. Officially, my job is titled “collections processor”, but unofficially I’d like to think of myself as more of a bug doctor. Continue reading “Much Ado About Mothing”