111/150: See no Weevil, Hear no Weevil, Speak no Weevil
Animalia: Arthropoda: Insecta: Coleoptera: Curculionidae: Otiorhynchus: Otiorhynchus sulcatus (Fabricius, 1775)
Not all weevils are evil, but unfortunately this species of weevil is quite a pest. The black vine weevil has been found to be a pest of over 100 different wild and cultivated plants. Unfortunately, this species is not the lesser of two evils since its larval and adult stage are both considered pests. The larval stage feeds on the roots of many plants, while the adults feed on the greenery of them. This species of weevil is capable of reproduction through parthenogenesis. Females reproduce specifically through thelytoky, where they produce unfertilized eggs without males. Thelytoky is a rare form of parthenogenesis and has only been recorded in around 1,500 species. Black vine weevils are a difficult pest to control because they have very few natural predators, and are nocturnal in nature. #Canada150 #Biodiversity150


Here’s the barcode sequence information for this species:
Process ID: JSCOL318-11
nucleotide sequence
TACCTTATATTTTATCTTCGGAGCTTGATCAGGAATAGTAGGAACTTCTTTAAATATACTTATTCGAATTCAACTAGGAATCCCAGGATCTTTAATTGGGGATGATCAATTTTATAACGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATAATAATTGGAGGTTTCGGAAACTGATTAGTCCCACTAATACATGGAGCTCCAGACATAGCTTTTCCTCGATTAAACAATATAAGATTTTGGCTACTCCCACCTTCTCTATCACTTTTATTAATAAGAAGAATTATTGATAAAGGAACAGGTACAGGATGAACTGTGTATCCACCCTTATCATCAAACATTGCACATGAAGGTGCCTCGGTAGATTTAGCAATCTTTAGATTACATATAGCAGGGGTTTCATCTATCCTAGGTGCTATTAATTTTATCTCGACAGCCATTAATATACGCCCAGGTGGGATATCCCTAGATCGTATATCATTATTTATCTGAGCCGTAAAAATTACTGCTATCTTATTACTTCTTTCACTTCCAGTATTAGCTGGGGCTATTACTATATTACTCACAGACCGAAATATTAATACCTCTTTCTTTGATCCGGCTGGTGGGGGAGATCCTATTCTATACCAACATTTATTT-
amino acid sequence
TLYFIFGAWSGMVGTSLNMLIRIQLGIPGSLIGDDQFYNVIVTAHAFIMIFFMVMPMMIGGFGNWLVPLMHGAPDMAFPRLNNMSFWLLPPSLSLLLMSSIIDKGTGTGWTVYPPLSSNIAHEGASVDLAIFSLHMAGVSSILGAINFISTAINMRPGGMSLDRMSLFIWAVKITAILLLLSLPVLAGAITMLLTDRNINTSFFDPAGGGDPILYQHLF-
Learn more about it’s BIN (Barcode Index Number): BOLD:AAW9297