#Biodiversity150 number 111 of 150 Black Vine Beetle

111/150: See no Weevil, Hear no Weevil, Speak no Weevil

Animalia: Arthropoda: Insecta: Coleoptera: Curculionidae: Otiorhynchus: Otiorhynchus sulcatus (Fabricius, 1775)

Not all weevils are evil, but unfortunately this species of weevil is quite a pest. The black vine weevil has been found to be a pest of over 100 different wild and cultivated plants. Unfortunately, this species is not the lesser of two evils since its larval and adult stage are both considered pests. The larval stage feeds on the roots of many plants, while the adults feed on the greenery of them. This species of weevil is capable of reproduction through parthenogenesis. Females reproduce specifically through thelytoky, where they produce unfertilized eggs without males. Thelytoky is a rare form of parthenogenesis and has only been recorded in around 1,500 species. Black vine weevils are a difficult pest to control because they have very few natural predators, and are nocturnal in nature. #Canada150 #Biodiversity150

Specimen BIOUG00990-D10 – Elizabethtown, Ontario – 24-Aug-2010. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
A Black Vine Weevil residing on a plant. Photo Credit: Denny Bruck goo.gl/V6mkW2

Here’s the barcode sequence information for this species:

Process ID: JSCOL318-11

nucleotide sequence

TACCTTATATTTTATCTTCGGAGCTTGATCAGGAATAGTAGGAACTTCTTTAAATATACTTATTCGAATTCAACTAGGAATCCCAGGATCTTTAATTGGGGATGATCAATTTTATAACGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATAATAATTGGAGGTTTCGGAAACTGATTAGTCCCACTAATACATGGAGCTCCAGACATAGCTTTTCCTCGATTAAACAATATAAGATTTTGGCTACTCCCACCTTCTCTATCACTTTTATTAATAAGAAGAATTATTGATAAAGGAACAGGTACAGGATGAACTGTGTATCCACCCTTATCATCAAACATTGCACATGAAGGTGCCTCGGTAGATTTAGCAATCTTTAGATTACATATAGCAGGGGTTTCATCTATCCTAGGTGCTATTAATTTTATCTCGACAGCCATTAATATACGCCCAGGTGGGATATCCCTAGATCGTATATCATTATTTATCTGAGCCGTAAAAATTACTGCTATCTTATTACTTCTTTCACTTCCAGTATTAGCTGGGGCTATTACTATATTACTCACAGACCGAAATATTAATACCTCTTTCTTTGATCCGGCTGGTGGGGGAGATCCTATTCTATACCAACATTTATTT-

amino acid sequence

TLYFIFGAWSGMVGTSLNMLIRIQLGIPGSLIGDDQFYNVIVTAHAFIMIFFMVMPMMIGGFGNWLVPLMHGAPDMAFPRLNNMSFWLLPPSLSLLLMSSIIDKGTGTGWTVYPPLSSNIAHEGASVDLAIFSLHMAGVSSILGAINFISTAINMRPGGMSLDRMSLFIWAVKITAILLLLSLPVLAGAITMLLTDRNINTSFFDPAGGGDPILYQHLF-

Visual representation of DNA barcode sequence for Black Vine Beetle

Learn more about it’s BIN (Barcode Index Number): BOLD:AAW9297

Leave a Reply

Your email address will not be published.