Fungi: Basidiomycota: Agaricomycetes: Agaricales: Agaricaceae: Calvatia: Calvatia gigantea (Batsch) Lloyd 1904
The Giant Puffball appears in the folklore of many cultures due to its large whimsical appearance. On average these mushrooms are 10-70 cm in diameter, but get as big as 150 cm! The Giant Puffball is one of many mushrooms found to develop ‘fairy rings’, which are associated with witchcraft in many cultures. A fairy ring is a perfect circle that is lined with individual mushrooms which are all connected beneath the surface by a shared mycelium. The Giant Puffball forms its fruiting body completely internally, so it does not have a stalk or visible gills which can help discerns it from other mushrooms. The immature puffball is completely white and entirely edible, however once it begins to form spores it becomes brown and inedible very quickly. Despite being common, it is always important to check with a specialist first before consuming mushrooms you find. Happy ‘shrooming this fall! #Canada150 #Biodiversity150
Here’s the barcode sequence information for this species:
Process ID: FUNGC001-16
nucleotide sequence
TTATACATTGTCCGGTAAAGGACGATTAGTAGCTGAACAAGCCAGAGAGCAATCATCACAGTGTAGATAATTATCACACTAGTGACGGGACTGCAAACGGTTCCGCTAATGCATTTCAGGAGAGCCGACCTCTATTACAGAGGCCCGCAAACTCCCACCTTCCAAGCCCCATCGCAACTCACAAAAGCTGGAGGGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAAGATTATTATAGGCCCATAGGCCCATTGATNACATTCTACAACATACTATGTGGTATATGAAAACATAGTGCTCGAAGGAGAGGTTTACAAGTCACTTTGAGAAGAGCTGTATGCTTTCGCACTCAGCAATCCTCACATCCGGAAAGGCCACATAGCCGTCCGATAGTTGACTGCTCTCAACCCCCAAGACTACAAAAGGTGCACAGGTGGATGAATAGAGTCAAGACAGGCGTGCACATGCTCCAAAGAGCCAGCTACAACCCATCAAGAATATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAT
Leave a Reply