116/150: The questionable habits of the Question Mark Butterfly

Animalia: Arthropoda: Insecta: Lepidoptera: Nymphalidae: Nymphalinae: Polygonia: Polygonia interrogationis (Fabricius 1798)

When thinking of territorial animals, the first ones that come to mind likely aren’t butterflies. The adult males of the question mark butterfly (Polygonia interrogationis) will defend their territory on trees they have perched on. They will leave their perch to chase away butterflies and other insects, and sometimes even birds! Adult question marks are also different from the stereotypical butterfly in another way – their main food source is not nectar. Instead, they feed mainly on rotting and fermenting fruit, tree sap, dung, and carrion. Only when these food sources aren’t available will they drink nectar. The second generation of these butterflies will overwinter as adults so this diet is thought to provide them an extra benefit since nectar is not as readily available into the fall and winter. The butterfly gets its name for the small question mark like symbol on the underside of its hindwing. You can read more about that here. #Canada150 #Biodiversity150

Here’s the caterpillar of the Question Mark butterfly. Video courtesy of Lauren Stitt.

Here’s the barcode sequence information for this species:

Process ID: CNCBF516-14

nucleotide sequence

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTCTTAGTCTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACAATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGACTCCTTCCCCCCTCATTATTTTTATTAATTTCTAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCTTCTAATATTGCTCATAGAGGATCATCAGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAACATACGAATTAATAATATATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTAGGTATTACAGCTTTACTTTTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACAGATCGTAATATTAATACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

amino acid sequence

TLYFIFGIWAGMVGTSLSLLIRTELGNPGSLIGDDQIYNTIVTAHAFIMIFFMVMPIMIGGFGNWLIPLMLGAPDMAFPRMNNMSFWLLPPSLFLLISSSIVENGAGTGWTVYPPLSSNIAHSGSSVDLAIFSLHLAGISSILGAINFITTIINMRINNMSFDQMPLFVWAVGITALLLLLSLPVLAGAITMLLTDRNINTSFFDPAGGGDPILYQHLF

Learn more about it’s BIN (Barcode Index Number): BOLD:ABZ5834