Animalia: Chordata: Amphibia: Caudata: Plethodontidae: Plethodontinae: Plethodon: Plethodon vehiculum (Cooper, 1860)

The western redback salamander is a relatively small salamander, measuring about 4 to 10 centimeters in length, and is commonly identified by distinctive stripe down their back. Though their name indicates this stripe as red, it can also be yellow, olive, and tan. In some cases, it doesn’t appear at all. Redbacks range from south-western British Columbia to southwestern Oregon, making their home in the moist microhabitats beneath leaf litter and fallen logs. Though fully terrestrial, these salamanders are still routinely found living near water sources.

This species belongs to the family Plethodontidae, commonly known as the lungless salamanders. As the name suggests, members of this family lack any internal lungs, and gas exchange happens instead through their skin. While this can be very efficient, it can put them at risk of dehydration and increase their sensitivity to environmental pollution. Knowing this, redbacks can be a great indicator species for healthy environments. There are 9 western redback salamanders with barcodes on BOLD. #Canada150 #Biodiversity150

Here’s the barcode sequence information for this species:

Process ID: CNPVT122-16

nucleotide sequence

CACCCTCTACCTAATATTTGGTGCCTGAGCCGGTATGGTTGGCACAGCCCTTAGTCTACTAATTCGAGCAGAACTTAGTCAACCAGGAGCATTACTTGGAGATGACCAGATTTACAACGTAATTGTAACTGCCCATGCCTTTGTAATAATTTTTTTTATGGTAATACCTGTTATGATCGGAGGATTTGGCAATTGACTTTTACCACTAATAATTGGTGCTCCAGACATGGCTTTTCCACGTATGAATAATATAAGTTTCTGACTTCTTCCCCCATCCCTTCTTCTCCTCCTTGCCTCTTCAGGCGTAGAAGCAGGTGCAGGCACCGGATGAACTGTATACCCCCCTTTGGCTGGAAATATAGCACATGCTGGCGCTTCAGTAGATCTTACTATTTTCTCGCTTCATCTTGCTGGAGTATCATCTATCCTTGGTGCTATTAATTTTATCACAACTTCTATTAATATAAAACCACCATCAATATCACAATATCAAACCCCACTATTTGTGTGATCTGTACTTATTACGGCCATTCTACTGTTACTTTCACTACCGGTACTAGCAGCAGGTATTACTATACTTCTTACTGACCGAAACCTAAATACAACATTTTTTGACCCGGCAGGCGGAGGCGACCCTGTATTGTACCAACACCTATTC

amino acid sequence

TLYLMFGAWAGMVGTALSLLIRAELSQPGALLGDDQIYNVIVTAHAFVMIFFMVMPVMIGGFGNWLLPLMIGAPDMAFPRMNNMSFWLLPPSLLLLLASSGVEAGAGTGWTVYPPLAGNMAHAGASVDLTIFSLHLAGVSSILGAINFITTSINMKPPSMSQYQTPLFVWSVLITAILLLLSLPVLAAGITMLLTDRNLNTTFFDPAGGGDPVLYQHLF

Learn more about it’s BIN (Barcode Index Number): BOLD:AAF2673