#Biodiversity150 number 122 of 150 Hagfish

122/150: Happy Hagfish Day!

Animalia: Chordata: Myxini: Myxiniformes: Myxinidae: Eptatretinae: Eptatretus: Eptatretus stoutii (Lockington, 1878)

The Pacific Hagfish is a jawless fish species that has a long, eel-like body. They are boneless, with only cartilage and keratin structures and flexible enough they can tie themselves into knots – a useful tool for applying some biting force when you have no jaw! They live up to 1000 meters below the surface, and feed on the carcasses of various aquatic animals, although they can go months without food. They are most famous for their unique predator evasion method: creating bucket loads of slime. Their skin is loose, and packed with slime glands, which – when grabbed by the biting mouth of a potential predator – release copious amounts of slime proteins. These fish can produce an immense quantity of slime in seconds, which makes them slippery and clogs up the mouths, and gills, of their attackers. Unfortunately their population is thought to be declining, because of their value in Asian eel-leather markets. #HagfishDay #Canada150 #Biodiversity150

Pacific Hagfish ties itself in knots to eat and remove itself from its own slime! Photo Credit: kinskarije goo.gl/i23yAH
Pacific Hagfish curled up and resting. Photo Credit: Jeanette_bham goo.gl/m26Dgg
Specimen NEOCAL07-0004 – Bamfield Inlet, British Columbia – 13-Jun-2007. Photo Credit: Dirk Steinke & Tyler Zemlak, Centre for Biodiversity Genomics

Here’s the barcode sequence information for this species:

Process ID: TZFPA151-07

nucleotide sequence

CCTTTATCTAATTTTTGGTGCATGAGCCGGAATAATCGGAACAGCTTTAAGTGTAATTATTCGAACAGAATTAAGCCAACCAGGGCCCTTAATTAACAATGACCAACTTTATAATACAATCATCACAGCCCATGCATTCATTATAATTTTCTTCATAGTTATACCAATTATAATTGGTGGTTTTGGAAACTGACTAGTACCATTAATAATTGGTGCACCAGATATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTTCCCCCTTCACTCCTTCTTCTACTTTCATCTTCCATAATTAGTTCTGGTGCAGGAACTGGGTGAACTGTTTACCCACCCCTTTCAAATCATATTTCACATATAGGCCCATCAGTAGATTTAACTATTTTCTCACTACACCTAGCAGGTGTTTCTTCCATTTTAGGAGCAATCAACTTTATCACTACTATTATCAACATAAAAATACAATCAATAACCATATATCACATCCCATTATTTGTATGATCAATCCTAATCACCACAATTTTACTTCTCCTTTCCCTGCCAGTTTTAGCTGCTGCCATCACTATACTACTTACTGATCGTAATCTCAATACTACCTTTTTCGATCCTTCTGGTGGAGGAGATCCTATCCTTTATCAACACCT-

amino acid sequence

LYLIFGAWAGMIGTALSVIIRTELSQPGPLINNDQLYNTIITAHAFIMIFFMVMPIMIGGFGNWLVPLMIGAPDMAFPRMNNMSFWLLPPSLLLLLSSSMISSGAGTGWTVYPPLSNHISHMGPSVDLTIFSLHLAGVSSILGAINFITTIINMKMQSMTMYHIPLFVWSILITTILLLLSLPVLAAAITMLLTDRNLNTTFFDPSGGGDPILYQHX

Visual representation of DNA barcode sequence for Hagfish

Learn more about it’s BIN (Barcode Index Number): BOLD:AAC6695

Leave a Reply

Your email address will not be published.