#Biodiversity150 number 127 of 150 Masked Hunter Bug

127/150: Happy Halloween! The Masked Hunter wears a costume of disguise!

Animalia: Arthropoda: Insecta: Hemiptera: Reduviidae: Reduviinae: Reduvius: Reduvius personatus (Linnaeus, 1758)

The Masked Hunter is a true bug belonging to the family Reduviidae, also known as the Assassin Bugs. In accordance to their dangerous sounding common name they are known to have a painful bite, but they are relatively harmless towards humans as they don’t feed on blood or transmit diseases. The nymphs of this species are very interesting because they exude a sticky substance from “head to toe” allowing them to collect dust, lint and other particles. This natural camouflage enables them to ambush their unsuspecting prey. The next time you see a dust bunny floating around your house take a closer look as it may be a Masked Hunter in disguise! #Canada150 #Biodiversity150 #Halloween

Specimen CNC#HEM300372 – Osoyoos, British Columbia – 20-Jun-2005. Photo Credit: CNC/BIO Photography Group, Centre for Biodiversity Genomics
A Masked Hunter nymph covered in sand as its costume for Halloween! Photo Credit: Chiswick Chap goo.gl/6FKrhN
Close-up view of the Masked Hunters piercing mouthparts. Photo Credit: Thomas Pieper goo.gl/H5PXkw

Here’s the barcode sequence information for this species:

Process ID: HMCN586-09

nucleotide sequence

AACTCTTTATTTTCTCTTCGGTGGCTGGGCAGGTATAGTAGGAACATCGCTCAGATGATTAATTCGAATTGAATTAGGACAACCAGGATCCTTCATCGGTGATGACCAAACATATAATGTTATAGTTACTGCACATGCATTCATTATGATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGGAACTGATTAGTACCCTTAATGATTGGGGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCCCCATCTCTCACTCTCTTAATTATAAGAAGTATTGTAGAAACAGGGGCAGGAACAGGATGAACCGTTTACCCCCCTCTATCAAGAAATATGAGACATGCAGGTGCATCCGTTGACCTTGCAATTTTTTCTCTTCACCTAGCAGGGATTTCATCAATCTTAGGAGCAATAAATTTTATTTCAACCATCATCAATATACGAACCGCGGGAATAACCCCCGAACGGATCCCTCTTTTTGTTTGATCAGTTGGTATTACTGCACTTCTCCTACTTCTCTCTTTACCTGTCCTAGCAGGAGCAATTACTATACTCCTAACAGATCGAAACTTTAATACAAGATTTTTTGACCCAGCTGGAGGGGGGGATCCTATTTTATATCAACATTTATTT

amino acid sequence

TLYFLFGGWAGMVGTSLSWLIRIELGQPGSFIGDDQTYNVMVTAHAFIMIFFMVMPIMIGGFGNWLVPLMIGAPDMAFPRMNNMSFWLLPPSLTLLIMSSIVETGAGTGWTVYPPLSSNMSHAGASVDLAIFSLHLAGISSILGAMNFISTIINMRTAGMTPERIPLFVWSVGITALLLLLSLPVLAGAITMLLTDRNFNTSFFDPAGGGDPILYQHLF

Visual representation of DNA barcode sequence for Masked Hunter Bug

Learn more about it’s BIN (Barcode Index Number): BOLD:AAH2979


Comments

Leave a Reply

Your email address will not be published. Required fields are marked *