128/150: The amazingly acrobatic eyed click beetle!

Animalia: Arthropoda: Insecta: Coleoptera: Elateridae: Agrypninae: Alaus: Alaus oculatus (Linnaeus, 1758)

Alaus oculatus belongs to the family Elateridae, a group commonly known as click beetles. These insects get their name from the unique clicking mechanism they all share. When one of these beetles finds itself upside down, it will arch so only the tip of its head and abdomen touch the ground, then quickly straighten itself. As it does this, a spine on their underside snaps into a groove on the thorax, launching the beetle into a flip and causing the distinctive clicking noise.

The eyed click beetle can be found throughout the deciduous forests and woodlands of North and Central America. The beetles are named for the spots on their back, which are commonly believed to ward off predators. While the adults of this species feed only on nectar, the larvae are carnivorous, feeding on other beetle larvae they find residing in rotting logs. There are 11 eyed click beetles with barcodes on BOLD. #Canada150 #Biodiversity150

Here’s the barcode sequence information for this species:

Process ID: TTCFW882-08

nucleotide sequence

AACCCTTTATTTTCTTTTCGGTGCATGAGCCGGAATACTAGGGACATCACTAAGATTATTGATCCGAGCCGAACTCGGTAATCCTGGATCTCTAATTGGAAATGATCAAATCTATAATGTCGTTGTTACTGCACACGCATTTATCATAATTTTCTTCATAGTTATACCAATTATAATCGGTGGATTCGGAAACTGATTAGTTCCACTTATACTTGGAGCCCCAGATATAGCATTCCCTCGAATGAATAACATAAGATTTTGACTCCTCCCTCCTTCACTATCCCTTCTTCTAATAAGAAGAATTGTAGAAAACGGTGCCGGAACAGGATGAACTGTCTATCCCCCCCTTTCAGCAAACATTGCCCACAGAGGTTCATCAGTTGATTTAGCCATTTTTAGACTGCATCTGGCAGGAATCTCATCAATTCTAGGAGCTGTAAATTTTATTTCTACAGTGATCAATATACGATCAACAGGAATTACCTTTGATCGAATACCTTTATTCGTATGAGCAGTAGCAATTACTGCCCTATTACTACTCCTGTCACTTCCTGTACTAGCAGGAGCAATCACAATATTATTAACAGACCGAAATCTCAACACCACCTTCTTTGATCCCGCAGGAGGAGGAGATCCAATTCTTTATCAACACTTATTT

amino acid sequence

TLYFLFGAWAGMLGTSLSLLIRAELGNPGSLIGNDQIYNVVVTAHAFIMIFFMVMPIMIGGFGNWLVPLMLGAPDMAFPRMNNMSFWLLPPSLSLLLMSSIVENGAGTGWTVYPPLSANIAHSGSSVDLAIFSLHLAGISSILGAVNFISTVINMRSTGITFDRMPLFVWAVAITALLLLLSLPVLAGAITMLLTDRNLNTTFFDPAGGGDPILYQHLF

Learn more about it’s BIN (Barcode Index Number): BOLD:AAH0252