#Biodiversity150 number 135 of 150 Two-spotted spider mite

135/150: This tiny mite can cause massive damage!

Animalia: Arthropoda: Arachnida: Trombidiformes: Tetranycinae: Tetranychinae: Tetranychus: Tetranychus urticae (C. L. Kock, 1836)

The two-spotted spider mite is of economic importance as it is a common pest worldwide.  It has been found to feed on more than 1,100 different species of plants! Including important crops such as maize, soy, citrus, apples, tomatoes, strawberries, and peppers. By sucking the cell contents from leaves, the mite leaves small lesions that in large numbers will reduce the photosynthetic capabilities of plants. It is highly resistant to pesticides so researchers sequenced its entire genome in 2011 to understand its biology to create more effective pesticides.

These mites are barely visible to the naked eye at 0.4 mm long and comes in many colours including brown, orange, and green. It is named for the two spots located symmetrically on each side of its back. These spots are actually the buildup of body waste that can be seen through the mite’s transparent body wall. Like all spider mites, the two-spotted variety can spin fine strands of web. #Canada150 #Biodiversity150

Specimen BIOUG08419-E08 – Wellington County, Guelph, Ontario, Canada – 30-May-2013. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
Web of the spider mite Tetranycus urticae. Photo Credit: University of Florida goo.gl/6jokcW
Colorized scanning electron microscope image of Tetranychus urticae. Photo Credit: Eric Erbe and Chris Pooley goo.gl/6jokcW
Eggs of the spider mite Tetranychus urticae. Photo Credit: Gilles San Martin goo.gl/65c6Cm

Here’s the barcode sequence information for this species:

Process ID: MBIOC060-13

nucleotide sequence

AACTATGTATTTTTTATTTAGATTATTTTCAGGACTTATAGGGACTTCAATAAGAATTATTATTCGATTAGAACTTATAACACCAGGATCATTAATTCAAAATGATTTTATTTATAATTCAATAGTTACAACGCACGCTATAATTATAATTTTTTTTATAGTTATACCAGCTATAATTGGAGGATTTGGAAATTGATTGATTCCTTTAATAATTAATACTGTAGATTTATGTTTTCCGCGAATTAATAATATAAGATTTTGATTGCTAATTCCTTCTTTAATATTAATAATTTCTTCATCCATAAAAAGTGTTTTAAATGGAGTGGGTTGAACAATATATCCCCCCCTAACTTCAATTCAATATTTTATGTCTTCCTCTATTGAAATAATAATTTTTTCTTTACATATTGCAGGAATTTCTTCAATTGCTAGATCTATTAATTTTATTTCAACTATTCTATTAATAAAAAATAAAAATTATTTTTTAAGAAATTTAACTTTATTTTCTTTATCAATTTTAATTACTACATTTTTACTTTTATTAGCATTACCTGTCTTAGCAGGAGCAATTACAATAATTTTAATAGATCGAAATTTTAATACATCATTTTTTGATCCAAGAGGAGGAGGAGACCCAATTTTATATCAACATTTATTT

amino acid sequence

TMYFLFSLFSGLMGTSMSIIIRLELMTPGSLIQNDFIYNSMVTTHAMIMIFFMVMPAMIGGFGNWLIPLMINTVDLCFPRINNMSFWLLIPSLMLMISSSMKSVLNGVGWTMYPPLTSIQYFMSSSIEMMIFSLHIAGISSIASSINFISTILLMKNKNYFLSNLTLFSLSILITTFLLLLALPVLAGAITMILMDRNFNTSFFDPSGGGDPILYQHL

Visual representation of DNA barcode sequence for Two-spotted spider mite

Learn more about it’s BIN (Barcode Index Number): BOLD:ABY3244


Comments

Leave a Reply

Your email address will not be published. Required fields are marked *