Animalia: Arthropoda: Insecta: Isoptera: Archotermopsidae: Zootermopsis: Zootermopsis angusticollis (Hagen, 1858)
Termites are insects that have survived for over 120 million years! Featured today is the Pacific Coast Dampwood Termite (Zootermopsis angusticollis). They are unlike most organisms by having complex social systems compromised of different castes of workers, soldiers and reproductives. Each caste serves a different function with workers having no sexual organs and being solely responsible for building, grooming and performing other duties for the colony. The soldiers resemble workers but have large mandibles that are used for protecting the colony against predators and competitors such as ants or other termites. The reproductives are future kings and queens tasked with starting new colonies, and are known for biparental care which increases their chance of survival as a colony by double! In an experiment comparing single parent vs. two parent colonies, 3 out of 4 single parent colonies became biparental which goes to show even termites get lonely! #Canada150 #Biodiversity150
Here’s the barcode sequence information for this species:
Process ID: CNGUG014-15
nucleotide sequence
ATTTTCGGAGCATGATCCGGAATACTAGGAACATCACTAAGAATGTTAATCCGAGCAGAGCTAGGTCAACCAGGATCTCTAATTGGAGATGACCAAATTTACAATGTAATTGTAACTGCACATGCATTCATCATAATTTTTTTCATAGTTATACCAATCCTAATTGGAGGTTTCGGAAACTGATTGGTCCCACTTATACTAGGAGCCCCTGATATAGCATTCCCCCGAATGAACAACATAAGATTTTGATTACTTCCACCCTCACTTACACTCCTCCTAACAAGAAGCATAGTAGAAAGAGGAGCTGGGACAGGATGAACGGTATACCCCCCATTAGCCAGAGGAATAGCTCATGCAGGAGCATCAGTTGACTTAACAATTTTTTCCCTACACTTAGCGGGTGTGTCATCAATTCTAGGAGCAGTAAATTTCATCTCAACAGCAATTAACATAAAACCATCAAGTATAAAATCTGAACAAATACCCTTATTTGTATGAGCAGTAATTATTACTGCCATTTTACTATTACTATCACTACCAGTATTAGCGGGG————————————————————————————
amino acid sequence
IFGAWSGMLGTSLSMLIRAELGQPGSLIGDDQIYNVIVTAHAFIMIFFMVMPILIGGFGNWLVPLMLGAPDMAFPRMNNMSFWLLPPSLTLLLTSSMVESGAGTGWTVYPPLASGMAHAGASVDLTIFSLHLAGVSSILGAVNFISTAINMKPSSMKSEQMPLFVWAVIITAILLLLSLPVLAG—————————-
Learn more about it’s BIN (Barcode Index Number): BOLD:ACD2582
Title Image: Specimen BIOUG18506-C06 – Gulf Islands National Park – 29-Aug-2014 – Malaise Trap
Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
Leave a Reply