24/150: 50 pairs of shoes? That’s a lot of footwear for a centipede

Animalia: Arthropoda: Chilopoda: Lithobiomorpha: Lithobiidae: Lithobius: Lithobius forficatus (Linnaeus 1758)

Centipede means “100 legs”, but despite the name they can have as little as 15 to as many as 177 pairs of legs! They also vary in size from 4 mm to over 30 cm based on the species of centipede. They prefer habitats that are damp and dark but are usually nocturnal meaning they are most active at night time. Using their long antennas for sensing and venom for paralysis they are able to hunt spiders, worms and even other centipedes! Lithobius forficatus, known as the brown centipede, was introduced to North America from Europe. It can range in size from 18 mm to 30 mm and are usually found in the top layers of soil as well as under rocks and rotting logs. They are born with only 7 pairs of legs gaining a new pair every time they molt within their 5 to 6 year life span. They are thankfully harmless to humans and can be found in gardens and forests across Canada. #Canada150 #Biodiversity150

Here’s the barcode sequence information for this species:

Process ID:  MYREC015-10

nucleotide sequence

AACTATATACTTTGTGCTAGGAATTTGGTCAGCAATAATTGGTACAGGTCTCAGCCTTCTTATTCGGCTAGAACTAAGCCAGCCCGGAAGTTTAATTGGAGATGACCAGATCTATAATGTTATTGTTACCGCCCATGCTTTCATTATAATCTTTTTTATGGTTATACCAATCATAATTGGAGGATTTGGAAACTGACTTGTCCCATTAATATTAGGGGCACCAGACATAGCCTTCCCACGAATAAATAACATAAGATTTTGACTCCTTCCCCCTTCATTAACCTTACTACTTTGCTCAGCAGCAGTGGAAAGAGGTGCAGGAACAGGTTGAACCGTCTATCCCCCTCTATCTTCTAATATCTCTCATAGAGGAGCATCAGTAGATATAACGATCTTTTCATTACACCTTGCTGGTGCGTCCTCAATTTTAGGGGCTATTAATTTTATTTCAACAATCATTAATATACGAACAAGAGGAATATCATTTGAGCGAGTACCCTTATTTGTATGATCAGTAAAAATTACAGTCATTTTACTCCTCTTATCTCTCCCAGTTTTAGCCGGGGCAATTACAATATTATTAACTGATCGAAACTTAAATACTAGATTCTTCGACCCCACAGGGGGAGGTGACCCAATCTTATATCAACATTTATTC

amino acid sequence

TMYFVLGIWSAMIGTGLSLLIRLELSQPGSLIGDDQIYNVIVTAHAFIMIFFMVMPIMIGGFGNWLVPLMLGAPDMAFPRMNNMSFWLLPPSLTLLLCSAAVESGAGTGWTVYPPLSSNISHSGASVDMTIFSLHLAGASSILGAINFISTIINMRTSGMSFERVPLFVWSVKITVILLLLSLPVLAGAITMLLTDRNLNTSFFDPTGGGDPILYQHLF

Learn more about it’s BIN (Barcode Index Number): BOLD:AAH6437

Title Image: Specimen 09BBMYR-081 – Gros Morne National Park – 12-Jul-2009
Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics