29/150: Save A Spider Day – The Spined Micrathena

animalia: Arthropoda: Arachnida: Araneae: Araneidae: Micrathena: Micrathena gracilis (Walckenaer, 1805)

Micrathena gracilis is a moderately large orb-weaver spider from family Araneidae, commonly known as the spined micrathena. The females are typically black with white markings and have five pairs of black spines which are conical tubercles on the upper side of the abdomen. There is great variability in colouration among these spiders. Females are usually larger and reach to about 1-1.5 cm, and the males are much smaller in size due to the presence of sexual dimorphism in this species. Females build a two-dimensional wheel-shaped web with a sticky spiral, designed to catch flying insects. Males do not knit their own web, but visit the female during mating. The spined micrathena is completely harmless to humans and commonly occurs in the forested areas, including settlements. Until recently it was thought that this species was encountered only in the United States but in recent years has been established in southern Ontario. #Canada150 #Biodiversity150

Here’s the barcode sequence information for this species:

Process ID:  ARONW639-14

nucleotide sequence

AACTTTATATCTAATTTTTGGTGCTTGATCTGCTATAGTAGGTACTGCTATAAGTGTTTTAATCCGTATTGAATTAGGACAGATAGGTAGATTTATAGGAGATGACCAGTTATATAATGTTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATATTAGGGGCTCCAGATATAGCTTTTCCGCGAATAAATAACTTGAGATTTTGATTATTACCTCCCTCGTTATTAATATTAATTATTTCTTCAATAGTTGAAATAGGGGTTGGGGCTGGATGAACTGTTTATCCTCCTTTAGCTTCACTAGAAGGACATGCTGGAAGATCAGTAGATTTTGCTATTTTTTCTTTACATTTAGCAGGGGCTTCTTCTATTATAGGGGCTATTAATTTTATTTCTACTATTTTAAATATACGAATGTTAGGAATAACAATGGAAAAGGTTCCTTTGTTTGTATGATCTGTTTTTATTACTGCTATTCTTTTGCTTTTATCTTTGCCAGTATTGGCTGGGGCTATTACTATATTATTAACTGATCGAAATTTTAATACCTCTTTTTTTGACCCTTCAGGGGGAGGGGATCCTATTTTATTTCAACATTTGTTT

amino acid sequence

TLYLIFGAWSAMVGTAMSVLIRIELGQMGSFMGDDQLYNVIVTAHAFIMIFFMVMPIMIGGFGNWLVPLMLGAPDMAFPRMNNLSFWLLPPSLLMLIISSMVEMGVGAGWTVYPPLASLEGHAGSSVDFAIFSLHLAGASSIMGAINFISTILNMRMLGMTMEKVPLFVWSVFITAILLLLSLPVLAGAITMLLTDRNFNTSFFDPSGGGDPILFQHLF

Learn more about it’s BIN (Barcode Index Number): BOLD:AAG3764

Title Image: Specimen BIOUG12603-E05 – Ojibway Prairie Provincial Park – 19-Aug-2014 – Free Hand
Photo Credit: G Blagoev, Centre for Biodiversity Genomics