42/150: Nature’s Underwater Architect
Animalia: Arthropoda: Insecta: Trichoptera: Limnephiloidea: Limnephilidae: Philarctus bergrothi (McLachlan, 1880)
Philarctus bergrothi is part of the northern caddisfly family Limnephilidae, which are found within higher elevations in the northern hemisphere. Caddisflies are closely related to moths and butterflies. While moths and butterflies have scales on their wings and bear terrestrial larvae, caddisflies have hairs on their wings and bear aquatic larvae. Inhabiting a variety of aquatic habitats, caddisfly larvae may follow a variety of lifestyles: predacious, herbaceous (leafy plants and algae), or particle collectors (water column and benthos). These larvae have hardened heads but soft bodies and typically create cases, using a variety of abiotic material and saliva, to use as armor. These cases are not only used for protection, but also used by humans as an art form! French artist Hubert Duprat creates artwork by providing wild caddisflies with glamourous stones or precious metals. #Canada150 #Biodiversity150



Here’s the barcode sequence information for this species:
Process ID: EBTCH323-11
nucleotide sequence
ACTATTTACTTTATTTTTGGAATTTGAGCTGGAATAATCGGAACTTCTTTAAGAATAATTATTCGAACTGAATTAGGTACAACTGAATCATTAATTAAAAATGATCAAATTTATAATGTACTAGTTACTGCCCATGCTTTTATTATAATTTTTTTTATGGTAATACCAATCATAATTGGTGGATTCGGTAATTGGCTTGTTCCCCTAATAATCGGTGCACCTGATATAGCTTTCCCTCGTATAAATAACATAAGATTTTGGTTACTACCCCCCTCTTTAAACCTCTTATTAATTAGTGCACTTATTGAAAGAGGAACGGGAACTGGTTGAACAGTATACCCCCCTCTTTCTAGAAACTTAGCTCACGCTGGAAGTTCCGTTGACATCTCCATTTTTTCCCTTCATTTAGCGGGTATTTCTTCAATTTTAGGAGCTATTAACTTTATTTCTACAACACTAAATATACGTAGTAACCTAATAACATTAGACCGAATTCCCCTATTTGTTTGATCAGTAGCTATTACAGCACTTTTACTTCTTCTTTCTTTACCGGTTTTAGCTGGAGCTATTACTATGTTATTAACAGATCGAAATCTAAATACCTCTTTTTTTGACCCCTCAGGGGGGGGTGATCCCATTTTATACCAACATTTATTT
amino acid sequence
TIYFIFGIWAGMIGTSLSMIIRTELGTTESLIKNDQIYNVLVTAHAFIMIFFMVMPIMIGGFGNWLVPLMIGAPDMAFPRMNNMSFWLLPPSLNLLLISALIESGTGTGWTVYPPLSSNLAHAGSSVDISIFSLHLAGISSILGAINFISTTLNMRSNLMTLDRIPLFVWSVAITALLLLLSLPVLAGAITMLLTDRNLNTSFFDPSGGGDPILYQHLF
Learn more about it’s BIN (Barcode Index Number): BOLD:AAA2068