Plantae: Magnoliophyta: Magnoliopsida: Fabales: Fabaceae: Lupinus: Lupinus sericeus (Pursh)
As attractive and colourful as this pea family member may be, the silky lupine holds its own dark secrets. Native to Manitoba and British Columbia in Western Canada, this stunning plant has been discovered to produce toxic alkaloids known to cause adverse consequences and even death to its consumers, which are typically domesticated livestock such as sheep, goats and cattle. Symptoms such as nausea, convulsions and lethargy have been noted in the afflicted animals. Nevertheless, certain animals such as deer and birds have been observed to consume this plant with no issue. Even species such as hummingbirds and honey bees have been known to frequent these flowers for they are full of nectar! Not too bad! #Canada150 #Biodiversity150
Here’s the barcode sequence information for this species: BBYUK1091-12
Process ID:
nucleotide sequence
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCCCGTGCCTTGGCCACGTGCCAGGCACCAAGCGGGGCGAATGTTGGCTTCCCGCGAGCAATGTCTCACGGTTGGTTGAAAACTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTTAAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTTTGACCCATGGGGGTCTGTTGGCCTTCTAATACGGGAACCTCAGGTCAGGCGGGGCTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAGCGGCGAGCGAACCGGGAAAAGCCCACCATGAGAATCGGTCGCCCTCGGTGTCCGA
Title Image: A purple Lupine
Photo Credit: David R. Tribble goo.gl/D93fNb
Leave a Reply