#Biodiversity150 number 51 of 150 Silky Lupine

51/150: A pea, or not a pea?

Plantae: Magnoliophyta: Magnoliopsida: Fabales: Fabaceae: Lupinus: Lupinus sericeus (Pursh)

As attractive and colourful as this pea family member may be, the silky lupine holds its own dark secrets. Native to Manitoba and British Columbia in Western Canada, this stunning plant has been discovered to produce toxic alkaloids known to cause adverse consequences and even death to its consumers, which are typically domesticated livestock such as sheep, goats and cattle. Symptoms such as nausea, convulsions and lethargy have been noted in the afflicted animals. Nevertheless, certain animals such as deer and birds have been observed to consume this plant with no issue. Even species such as hummingbirds and honey bees have been known to frequent these flowers for they are full of nectar! Not too bad! #Canada150 #Biodiversity150

CCDB-18330-C6 – Castlegar, British Columbia – 15-Jun-2002 Photo Credit: Masha Kuzmina, Centre for Biodiversity Genomics
A Canadian Tiger Swallowtail on wild lupine. Photo Credit: D. Gordon E. Robertson goo.gl/WR6axo
Silky Lupine in bloom. Photo Credit: Andrey Zharkikh goo.gl/qufvFB

Here’s the barcode sequence information for this species: BBYUK1091-12

Process ID:

nucleotide sequence

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCCCGTGCCTTGGCCACGTGCCAGGCACCAAGCGGGGCGAATGTTGGCTTCCCGCGAGCAATGTCTCACGGTTGGTTGAAAACTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTTAAAGCTCGAGACCGATCGTGCGTGTCACCCCCACCAGCTTTGCGACTCTTTGACCCATGGGGGTCTGTTGGCCTTCTAATACGGGAACCTCAGGTCAGGCGGGGCTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAGCGGCGAGCGAACCGGGAAAAGCCCACCATGAGAATCGGTCGCCCTCGGTGTCCGA

Visual representation of DNA barcode sequence for Silky lupine

Title Image: A purple Lupine
Photo Credit: David R. Tribble goo.gl/D93fNb

 

 

 

 

Leave a Reply

Your email address will not be published.