#Biodiversity150 number 54 of 150 Nemertea Ribbon Worm

54/150: Imagine a worm 60 metres long!

Animalia: Nemertea: Enopla: Monostilifera: Emplectonematidae: Paranemertes: Paranemertes peregrina (Coe, 1901)

Nemertea, also known as “ribbon worm” is a phylum of marine invertebrate worm-like animals that are characterized by their eversible proboscis. The proboscis is used to catch prey and comes out of the nemertean’s body and stabs its prey with a venomous tip. Nemertean worms may be the longest animal on Earth, however it is difficult to measure them, they have been found at over 30 m long and estimated to grow to 60 m, longer than a Blue Whale! They also have regenerative properties and can grow back parts of their body or even whole new worms after a predator attack. #Canada150 #Biodiversity150

Specimen BN2010-009 – Intertidal mudflat on eelgrass bed, British Columbia, Canada – 12-Jun-2010. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
Illustration of Lineus longissimus, one of the longest animals on Earth. Photo Credit: Helena Samuelsson goo.gl/cKdegh

Here’s the barcode sequence information for this species:

Process ID:  OPQCS042-10

nucleotide sequence

GTCTTTATATTTTTTATTTGGGGTGTGGTCAGGTTTGGTTGGGACTGCTTTAAGGTTGTTGATTCGTGCTGAGCTTGGGCAGCCTGGGGCTCTTTTAGGGGATGATCAATTATATAATGTTATTGTCACGGCTCATGCTTTTGTAATGATTTTTTTTTTAGTTATGCCCGTAATAATTGGAGGGTTTGGAAATTGATTGGTTCCTTTAATGTTGGGGGCACCTGATATAGCATTTCCTCGTATAAATAATATAAGATTTTGATTGCTGCCACCGGCGTTAGTATTACTTCTATCTTCTGGGGCAGTTGAAAGAGGGGCTGGTACCGGATGAACTGTTTACCCTCCTTTGTCTAGAAATATTGCTCATGCTGGAGGTTCTGTAGATTTAGCTATTTTTTCTCTTCATCTGGCTGGGGTTTCTTCTATTTTAGGTGCTATTAATTTTATTACTACTATTGTTAATATGCGGTGGTATGGAATGCAGTTTGAGCGGTTGTCGTTGTTTGTGTGGTCTGTAAAGATTACGGCCGTTCTTCTTCTTCTTTCCCTTCCAGTTTTAGCTGGGGCAATTACAATATTATTAACAGATCGGAATTTTAATACTTCTTTTTTTGACCCTGCTGGTGGGGGAGACCCAATTTTATATCAGCATTTAT–

amino acid sequence

SLYFLFGVWSGLVGTALSLLIRAELGQPGALLGDDQLYNVIVTAHAFVMIFFLVMPVMIGGFGNWLVPLMLGAPDMAFPRMNNMSFWLLPPALVLLLSSGAVESGAGTGWTVYPPLSSNIAHAGGSVDLAIFSLHLAGVSSILGAINFITTIVNMRWYGMQFERLSLFVWSVKITAVLLLLSLPVLAGAITMLLTDRNFNTSFFDPAGGGDPILYQHLX

Visual representation of DNA barcode sequence for Nemertea ribbon worm

Learn more about it’s BIN (Barcode Index Number): BOLD:AAL3452

Leave a Reply

Your email address will not be published. Required fields are marked *