61/150: Some caterpillars love to eat insects!

animalia: Arthropoda: Insecta: Lepidoptera: Lycaenidae: Miletinae: Feniseca: Feniseca tarquinius (Fabricius, 1793)

When thinking of a typical caterpillar, you may picture one happily munching away on leaves. Not all caterpillars, however, feed on plants. The caterpillars of the harvester butterfly (Feniseca tarquinius) are actually insectivorous, meaning they feed on insects. This is the only species of butterfly in North America that feeds this way. They typically eat aphids or other true bugs such as scale insects. The female butterflies purposefully lay their eggs in or near colonies of aphids so that when the eggs hatch the caterpillars are right at their food source. To protect themselves from predators, such as ants, the caterpillars will often cover themselves in the carcasses of the aphids they have eaten. There are 162 barcodes for the harvester on BOLD. #Canada150 #Biodiversity150

Here’s the barcode sequence information for this species:

Process ID:  CNCBF1037-14

nucleotide sequence

AACTTTATACTTTATCTTCGGTATTTGAGCAGGTATATTGGGTACCTCCTTGAGCATCTTAATCCGTTTAGAATTAAGAACTCCTAACTCTCTTATTGGAAATGATCAAATTTATAACACTATTGTTACAGCACATGCTTTTATTATAATTTTCTTTATAGTTATGCCCATTATAATTGGAGGATTTGGAAACTGATTAGTTCCCTTAATACTGGGATCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTCTCCCTCCCTCCCTATTACTATTAATTTCAAGAAGAATTGTTGAAAATGGGGCTGGAACCGGTTGAACTGTATATCCACCCCTATCTTCCAATATTGCTCATAATGGAGCTTCAGTTGACTTAGCCATTTTCTCTTTACATTTAGCCGGAATTTCATCAATTTTAGGGGCTATTAACTTTATTACAACTATTATTAACATACGAATTAATAACTTATCATTTGATAAATTATCCTTATTTATTTGAGCAGTAGGGATTACGGCCCTTCTTCTACTTTTATCTCTTCCTGTTTTAGCAGGAGCTATTACTATATTGTTAACTGACCGAAACTTAAATACATCCTTTTTTGATCCTTCAGGAGGAGGTGACCCAATTTTATATCAACATTTATTC

amino acid sequence

TLYFIFGIWAGMLGTSLSILIRLELSTPNSLIGNDQIYNTIVTAHAFIMIFFMVMPIMIGGFGNWLVPLMLGSPDMAFPRMNNMSFWLLPPSLLLLISSSIVENGAGTGWTVYPPLSSNIAHNGASVDLAIFSLHLAGISSILGAINFITTIINMRINNLSFDKLSLFIWAVGITALLLLLSLPVLAGAITMLLTDRNLNTSFFDPSGGGDPILYQHLF

Learn more about it’s BIN (Barcode Index Number): BOLD:AAJ0404