6/150: Yellow cedars get cold feet
Plantae: Pinophyta: Pinidae: Pinales: Cupressaceae: Callitropsis: Callitropsis nootkatensis (D. Don, 1824)
One of the oldest known trees in Canada is a Yellow Cedar (Callitropsis nootkatensis), and its estimated age is over 1800 years! Unfortunately the tree was discovered after having been cut down in a clear cut operation in 1980. The species is named after First Nations Nuu-chah-nulth (Nootka) tribe of Vancouver Island where it was first recorded, however it can be found all along the west coast of North America from Northern California to Alaska. The tree can grow to over 40 meters and is highly valued for its rot-resistant and uniform timber and had many uses in Aboriginal culture. In recent years, C. nootkatensis have been dying out on a large scale raising concern. Scientists have determined this is a result of root freezing which eventually causes the entire tree to die. The shallow root system is usually protected by snow which acts as an insulator but due to recent reductions in snow levels the roots are vulnerable to freezing. Efforts are now being made to conserve this culturally and economically important tree in a changing climate. #Canada150 #Biodiversity150
Synonyms: Chamaecyparis nootkatensis, Xanthocyparis nootkatensis, Cupressus nootkatensis
Other names: Alaska cedar and Nootka cypress
Here’s the barcode sequence information for this species:
Process ID: VASCB025-15
nucleotide sequence
TGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTCGGCCAAGGGCACGTCTGCTTGGGCGTCGCACTCCAAGTTCGCCCTCCCTGGCGGAGGAGCGTAGATGGCCGTCCGTGTCCGATTGTGGTGCGGTCGGCTGAAATGAGCACGAGGTCCGTCGATCTGTCGCGACGAGCGGTGGCCTATGAAGGTCGGCGTTGGTTTGTGCAGTTCGAGCGAGGCCGAGTGTGGAACTTTAAATTGGCCACAGCGGCCTGCCATAGTGCGGGCATGTTGGGCCCCTTCCGCGTCCCCAAGTCAGGCGTGAATACCCGCTGAGTTTAA————————————————————
