66/150: Well, that is just dumb luck

Plantae: Pteridophyta: Pteridopsida: Hydropteridales: Marsileaceae: Marsilea vestita (Linnaeus)

Don’t be fooled, Hairy waterclover (Marsilea vestita) may LOOK like something that could give you a lifetime of good luck, but in reality are just four-leaf clover wannabes. Hairy waterclover, also known as Hairy pepperwort, is a type of aquatic fern that you can find in damp areas such as vernal pools, ponds and muddy banks. So what is the difference between our lucky clover and Marsilea vestita, you may ask? Well, whereas clovers have flowers to help with reproduction, waterclover instead develops hairy spore cases that release spores when water levels are low. These spore cases resemble peppercorns, giving the waterclovers their clever nickname! Spore cases contain male spores (microspores) and female spores (megaspores) which eventually germinate into small male and female plants. These tiny male and female plants produce sperm and eggs, which then combine during the fertilization process. The end result of this reproductive process is a young waterclover plant, which will never be able to live up to its distant relative’s name. Now that is REALLY dumb luck. #Canada150 #Biodiversity150

Here’s the barcode sequence information for this species:

Process ID:  PCCMN435-14

nucleotide sequence

GCGCCCGAGGCTCGTCCGAGGGCACGTCTGCCTGAGCGTCCACTTCACCCCCTCGCCCGACCCTCCTCGCGGGAGTCGGGCGGAGTTGGTCGTCCGTCCTCGTCTCGCCCCTACGTTCCTGCGGGAGTTCGGGGGGCGACGACGGAGAGCGGTCGGCTCAAATTCATCGATTGCGCTTTTCGCGGACGGGTGCTGCACGGGTGATTCTGTTCCCGGACGAACCTCGTTCGGCCGGGGCGGCTCTGCGGCCTCCGTCTCGCTGGCGCGCGTGTCGAAACGAAACGGGCTCCGTGCTCGGGACGCGTGGGGCTCGCTCCTCCTC