70/150: When you think of Ginseng do you think of Canada? You will after reading this!

Plantae: Magnoliophyta: Magnoliopsida: Apiales: Araliaceae: Panax quinquefolius (Linneaus)

Ginseng is a perennial herb whose root is highly prized and commonly refers to one of two varieties, American Ginseng (P. quinquefolius) or Asian Ginseng (P. ginseng). Both contain ginsenosides, which are the compounds thought to give ginseng its medicinal properties. Historically used in many cultures, including the Indigenous populations of North America, ginseng is still important to Canada today. Ontario is the world’s largest producer of American ginseng and due to its importance to the Canadian economy as early as the 16^th century, ginseng has been overharvested in Ontario and wild plants are now protected under the Endangered Species Act, 2007. Lab studies have shown that American ginseng is effective in boosting the immune system and lowering blood sugar in diabetes patients, however the other medicinal benefits attributed to ginseng have yet to be conclusively proven and it is generally considered a species that scientists do not fully understand! #Canada150 #Biodiversity150

Here’s the barcode sequence information for this species:

Process ID:  HIMS1456-12

nucleotide sequence

TTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCGGAGCGCACGTCGAGGACGGCGCAACAGGGTCATGAGAGCTTTTGCTGGCGACGGGTCACCGCACGACATGAGAAGAGGGCTTTTTACAACCACCACTTGTCGTGACGTCCATCGCCAAGGACTCGCATTTGGGCCAACCGCGCGGTGAGACACGGGAGGCCATTATCCGCCCCTCCGCCTCGACTCCCGCAAAGGAGTGATGGGTTGGGGGGCGACGCGATGCGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCA————————————————————————————————————————————————————————————————————————————-