Animalia: Arthropoda: Insecta: Hemiptera: Belostomatidae: Belostomatinae: Belostoma: Belostoma flumineum (Say, 1832)

Happy Father’s Day! Belostoma flumineum is a member of the genus Belostoma, commonly known as giant water bugs. These predatory insects can be found in wetlands, marshes, and ponds across North America, and can grow to be about 2.5 cm long. Though commonly known for their impressive size and painful bite, they’ve also got very dedicated fathers! When these insects were first spotted carrying their eggs, it was assumed to be the females protecting the brood. As it turns out, it’s the male that cares for them until they hatch. His task is not only to protect the young from predators, but also make sure they can breathe! Since the eggs are quite large, gas exchange is very limited. The father will stay close to the water’s surface, and stroke the brood with his hind legs to encourage the flow of water and increase oxygen access. After 7-14 days in his care, the young hatch and go on their way. #Canada150 #Biodiversity150

Here’s the barcode sequence information for this species:

Process ID:  CNCHA750-11

nucleotide sequence

AACCCTTTACTTCCTATTTGGGATCTGATCAGGGATGGTAGGAACTGCACTAAGATGACTTATTCGAATTGAACTAGGTCAACCAGGATCATTTATTGGAGATGACCAGATTTATAATGTTATTGTTACAGCTCATGCATTTATCATAATTTTCTTTATAGTTATGCCAATTATAATTGGAGGATTTGGAAACTGACTAGTACCTCTAATAATTGGTGCTCCAGATATGGCTTTCCCACGAATAAATAATATAAGATTCTGACTTCTTCCCCCCGCACTTACTCTTCTTTTATCAAGTAGCATTGTAGAAAGAGGAGCAGGAACTGGATGAACAGTTTATCCTCCCCTCTCAACTAATATTTCACATATAGGAGCAAGAGTAGATCTTGCCATTTTTTCATTACACCTGGCCGGTGTATCATCTATTTTAGGAGCAGTTAATTTTATTTCAACTATTATTAACATGCGAGCAACAGGCATATCCCCTGATCGTATACCATTATTTGTTTGATCAGTAGGAATTACAGCACTTCTACTCCTACTGTCATTACCTGTACTAGCCGGAGCAATTACTATACTCCTTACTGATCGAAATTTTAATACATCATTCTTTGACCCTGCCGGGGGAGGAGACCCAATTCTCTATCAACACTTATTC

amino acid sequence

TLYFLFGIWSGMVGTALSWLIRIELGQPGSFIGDDQIYNVIVTAHAFIMIFFMVMPIMIGGFGNWLVPLMIGAPDMAFPRMNNMSFWLLPPALTLLLSSSIVESGAGTGWTVYPPLSTNISHMGASVDLAIFSLHLAGVSSILGAVNFISTIINMRATGMSPDRMPLFVWSVGITALLLLLSLPVLAGAITMLLTDRNFNTSFFDPAGGGDPILYQHLF

Learn more about it’s BIN (Barcode Index Number): BOLD:AAZ0987

Title Image: Specimen CNC#HEM301054 – Quebec, Canada – 19-Sep-2000
Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics