Animalia: Arthropoda: Insecta: Hymenoptera: Ichneumonidae: Rhyssinae: Megarhyssa: Megarhyssa atrata (Fabricius, 1781)

At first glance, Megarhyssa atrata may slightly resemble small dragons due to their extremely long ovipositor! They can be found from May to June in North America, ranging all the way from Quebec to Florida. The Megarhyssa genus is known to have species with the longest ovipositors ever recorded in the insect world. These wasps also belong to the family of parasitoid wasps Ichneumonidae. The difference between these parasitoid wasps and other parasites is that these wasps eventually kill their host, whereas parasites tend to keep their host alive. Their long ovipositor is used to pierce dead deciduous trees to lay their eggs deep within the wood. The larvae hatch shortly after and parasitize larval wood-boring insects such as horntail wasps, but will also target the pupae of other wasps, beetles, and moths. #Canada150 #Biodiversity150

Here’s the barcode sequence information for this species:

Process ID:  BBHEC188-09

nucleotide sequence

————————ATGATCAGGTATAATTGGATCCTCAATAAGACTAATTATTCGAATTGAATTAGGAAACCCAGGATATCTCATTAATAATGACCAAATTTATAACTCAATTGTAACTGGTCACGCATTCATCATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGTAATTGACTAATCCCTCTCATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTCCTACCCCCATCCCTAATATTACTAATATTTAGAAATTTAATTAATCAAGGAGTTGGAACAGGATGAACTTTATACCCCCCCCTTTCCTCTAATATTAATCATGAAGGTATATCAGTAGACCTTTCCATTTTTTCACTTCATTTAGCTGGAATATCCTCTATTATAGGAGCAATTAATTTTATCTCAACTATTATTAATATACGCCCTAACCTTATATCAATAGAAAAAATATCTTTATTTTCTTGATCTATCCTAATCACTGCAATTTTACTCCTCTCAGCTGTCCCCGTATTAGCAGGGGCAATCACCATATTATTAACAGATCGAAATTTAAATTCATCCTTTTTTGACCCTTCAGGAGGCGGTGATCCTATTCTTTTCCAACATCTATTT

amino acid sequence

WSGMIGSSMSLIIRIELGNPGYLINNDQIYNSIVTGHAFIMIFFMVMPIMIGGFGNWLIPLMLGAPDMAFPRMNNMSFWLLPPSLMLLMFSNLINQGVGTGWTLYPPLSSNINHEGMSVDLSIFSLHLAGMSSIMGAINFISTIINMRPNLMSMEKMSLFSWSILITAILLLSAVPVLAGAITMLLTDRNLNSSFFDPSGGGDPILFQHLF

Learn more about it’s BIN (Barcode Index Number): BOLD:AAO8218