77/150: Mapleleaf Mussel – Important environmental indicators of Canadian Rivers and Lakes

Animalia: Mollusca: Bivalvia: Unionoida: Unionidae: Ambleminae: Quadrula: Quadrula quadrula (Rafinesque, 1820)

The Mapleleaf mussel is a freshwater mussel found in North America. Mapleleaf mussels are a threatened species in Ontario since 2008 and have completely disappeared from Lake Erie, Detroit and Niagara rivers. The main threats to this species are habitat destruction, invasive Zebra mussels from Europe and any conditions which threaten their host fish, the Channel Catfish. Mapleleaf mussels undergo a complex lifecycle which includes a parasitic phase of juvenile mussels. The mother Mapleleaf mussel presents a lure which gives her the appearance of being dead. Dead mussels being a favourite food of the Channel Catfish, entices the fish to take a bite while the mussel releases her larvae, allowing them to attach to the gills and absorb nutrients as they grow. As adults they have average life spans of 22 years and are important indicators of environmental health due to their complex lifestyles. There are five Mapleleaf mussels with barcodes on BOLD. #Canada150 #Biodiversity150

Here’s the barcode sequence information for this species:

Process ID:

nucleotide sequence

AACTTTATATTTGTTGCTGGCTTTGTGGTCTGGTTTAATTGGGTTGGCTTTGAGGCTTTTGATTCGGGCTGAGTTGGGGCAACCTGGTAGATTATTGGGAGATGATCAGTTGTATAATGTGATTGTGACGGCTCATGCTTTTATGATGATCTTTTTTTTGGTGATGCCAATGATAATTGGTGGTTTTGGTAATTGACTTATCCCACTTATGATTGGGGCTCCGGATATGGCTTTTCCTCGGTTAAATAATCTTAGTTTTTGGTTGCTTGTGCCAGCTCTTTTTTTGTTATTAAGATCTTCTATGGTAGAAAGGGGTGTTGGGACTGGTTGGACGGTTTATCCTCCGTTGTCTGGGAATATTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATCTTTTCTTTGCATCTTGCGGGAGCATCTTCTATTTTGGGGGCTATTAATTTTATTTCTACTGTTGGTAACATGCGGTCTCCTGGGTTGGTGGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTACAGTAACAGCAGTTTTATTGGTTGCGGCGTTACCTGTTTTAGCTGGTGCTATCACGATGCTACTTACGGATCGTAATATTAATACATCTTTTTTTGACCCTGTTGGGGGAGGTGATCCTATTTTGTATATGCA—————

amino acid sequence

TLYLLLALWSGLIGLALSLLIRAELGQPGSLLGDDQLYNVIVTAHAFMMIFFLVMPMMIGGFGNWLIPLMIGAPDMAFPRLNNLSFWLLVPALFLLLSSSMVESGVGTGWTVYPPLSGNIAHSGASVDLAIFSLHLAGASSILGAINFISTVGNMRSPGLVAERIPLFVWAVTVTAVLLVAALPVLAGAITMLLTDRNINTSFFDPVGGGDPILYMX—–

Learn more about it’s BIN (Barcode Index Number): BOLD:AAE7541