Fungi: Asomycota: Sordariomycetes: Xylariales: Xylariaceae: Xylaria: Xylaria polymorpha (Greville, 1824)

Contrary to its creepy common name, Dead man’s fingers, Xylaria polymorpha is an important fungus in the forest ecosystem with a black outer layer and white inside. This fungus is a saprotroph meaning they obtain energy from decaying matter and are seen from May to November. They break down dead material making nutrients accessible for other organisms consume. The name, Dead man’s fingers come from their odd, un-uniformly shaped fruiting bodies which resemble fingers poking out of the ground. They are widely distributed in deciduous forests of North America and Europe preferring to grow on apple, maple, locust and elm trees. Their scientific name literally means grows on trees (Xylaria) and many shapes (Polymorpha). They have an uncommonly long spore distribution period, allowing the fruiting bodies to persist for months and even years and spread very successfully. There is 1 representative on BOLD with barcode records. #Canada150 #Biodiversity150

Here’s the barcode sequence information for this species:

Process ID: RRFNL029-15

nucleotide sequence

AGGGATCATTAAAGAGTTTTATAACTCCCAAACCCATGTGAACATACTGTACGTTGCCTCGGCAGGCTGCATCTCCCTGTGAGGTCTTACCCTGTAGGACGCTACCGCTGTAAGGCTTATCGGGAAGATGCACTAAAGCCTGCCGGCGGCCCATTAAACTCTGTTTATTTTTGAATTCTGAGGTTATAATAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCACTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCCCTGTTGCTTAGTGTTGGGAGCCTACGGTTACCGTAGCTCCTCAAATGTAGTGGCGGAGTTGGTTCACACTCTAGACGTAGTAATTTTTATCTCGCCTATGAGTTGGACCGGTCCCTCGCCGTAAAACCCCCTAAAATTTTAAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA