128/150: The amazingly acrobatic eyed click beetle!

Animalia: Arthropoda: Insecta: Coleoptera: Elateridae: Agrypninae: Alaus: Alaus oculatus (Linnaeus, 1758)

Alaus oculatus belongs to the family Elateridae, a group commonly known as click beetles. These insects get their name from the unique clicking mechanism they all share. When one of these beetles finds itself upside down, it will arch so only the tip of its head and abdomen touch the ground, then quickly straighten itself. As it does this, a spine on their underside snaps into a groove on the thorax, launching the beetle into a flip and causing the distinctive clicking noise.

The eyed click beetle can be found throughout the deciduous forests and woodlands of North and Central America. The beetles are named for the spots on their back, which are commonly believed to ward off predators. While the adults of this species feed only on nectar, the larvae are carnivorous, feeding on other beetle larvae they find residing in rotting logs. There are 11 eyed click beetles with barcodes on BOLD. #Canada150 #Biodiversity150

Specimen 10BBCOL-0567 – Texas, United States – 03-Apr-2010 – UV Light Trap. Photo Credit: CBG Photography Group, Centre for Biodiversity Genomics
An eyed click beetle crawling on a log. Photo Credit: Henry Hartley goo.gl/UxhmBu

Here’s the barcode sequence information for this species:

Process ID: TTCFW882-08

nucleotide sequence

AACCCTTTATTTTCTTTTCGGTGCATGAGCCGGAATACTAGGGACATCACTAAGATTATTGATCCGAGCCGAACTCGGTAATCCTGGATCTCTAATTGGAAATGATCAAATCTATAATGTCGTTGTTACTGCACACGCATTTATCATAATTTTCTTCATAGTTATACCAATTATAATCGGTGGATTCGGAAACTGATTAGTTCCACTTATACTTGGAGCCCCAGATATAGCATTCCCTCGAATGAATAACATAAGATTTTGACTCCTCCCTCCTTCACTATCCCTTCTTCTAATAAGAAGAATTGTAGAAAACGGTGCCGGAACAGGATGAACTGTCTATCCCCCCCTTTCAGCAAACATTGCCCACAGAGGTTCATCAGTTGATTTAGCCATTTTTAGACTGCATCTGGCAGGAATCTCATCAATTCTAGGAGCTGTAAATTTTATTTCTACAGTGATCAATATACGATCAACAGGAATTACCTTTGATCGAATACCTTTATTCGTATGAGCAGTAGCAATTACTGCCCTATTACTACTCCTGTCACTTCCTGTACTAGCAGGAGCAATCACAATATTATTAACAGACCGAAATCTCAACACCACCTTCTTTGATCCCGCAGGAGGAGGAGATCCAATTCTTTATCAACACTTATTT

amino acid sequence

TLYFLFGAWAGMLGTSLSLLIRAELGNPGSLIGNDQIYNVVVTAHAFIMIFFMVMPIMIGGFGNWLVPLMLGAPDMAFPRMNNMSFWLLPPSLSLLLMSSIVENGAGTGWTVYPPLSANIAHSGSSVDLAIFSLHLAGISSILGAVNFISTVINMRSTGITFDRMPLFVWAVAITALLLLLSLPVLAGAITMLLTDRNLNTTFFDPAGGGDPILYQHLF

Visual representation of DNA barcode sequence for Eyed click beetle

Learn more about it’s BIN (Barcode Index Number): BOLD:AAH0252

118/150: A snake that plays possum

Animalia: Chordata: Reptilia: Squamata: Colubridae: Dipsadinae: Heterodon: Heterodon platirhinos (Latreille, 1801)

The eastern hognose snake is named for its distinctive upturned snout, which it uses to dig through sandy soil. Individuals average about 28 inches in length, with the females typically being larger than males. They are found in several pockets of eastern North America, and can come in a variety of colour combinations depending on their locale. Continue reading “118/150: A snake that plays possum”

71/150: A lesser known truth of giant water bugs

Animalia: Arthropoda: Insecta: Hemiptera: Belostomatidae: Belostomatinae: Belostoma: Belostoma flumineum (Say, 1832)

Happy Father’s Day! Belostoma flumineum is a member of the genus Belostoma, commonly known as giant water bugs. These predatory insects can be found in wetlands, marshes, and ponds across North America, and can grow to be about 2.5 cm long. Though commonly known for their impressive size and painful bite, they’ve also got very dedicated fathers! Continue reading “71/150: A lesser known truth of giant water bugs”

57/150: Providing A Good Start: The unique parental care of Wolf Spiders

Animalia: Arthropoda: Arachnida: Araneae: Lycosidae: Trochosa: Trochosa ruricola (De Geer, 1778)

The Rustic Wolf Spider belongs to the family Lycosidae, and is known for its keen eyesight and skilled hunting. They occur in a wide range of habitats, including grasslands, woodlands, and scrubs across the globe. While many spiders lay their eggs and leave them be, wolf spiders will go the extra mile to protect their young. Continue reading “57/150: Providing A Good Start: The unique parental care of Wolf Spiders”