131/150: What has a lion’s mane and lives under the sea? A jellyfish!

Posted on November 9, 2017 by Kristin Rodrigo

Animalia: Cnidaria: Scyphozoa: Semaeostomeae: Cyaneidae: Cyanea: Cyanea capillata (Linnaeus, 1758)

The Lion’s Mane jellyfish is the largest species of jellyfish in the world. The largest specimen was found in 1870 at Massachusetts Bay, United States with a bell diameter of 2.3 meters and tentacles reaching 37 meters, which is longer than the length of a blue whale! These magnificent creatures are known to like cold temperatures and live around northern hemisphere in the north Atlantic, Pacific and Arctic oceans. Due to their large size, certain fish and shrimp species find protection and shelter from their predators by hiding around the jellyfish’s body. As for their diet, the lion’s mane jellyfish’s favourites are zooplankton, moon jellies and ctenophores. They live a pelagic lifestyle, roaming around open seas and often fall to prey to seabirds, ocean sunfish and other jellyfish species. In fact, the leatherback sea turtle feeds almost entirely on this species. Uhm, yum? #Canada150 #Biodiversity150

Small, juvenile lion’s mane jellyfish appear in tan and orange colours, but as they get older, they turn into a reddish or purplish shade. Photo Credit: Brian Gratwicke goo.gl/DkBexQ

The bell of the lion’s mane jellyfish can reach a diameter of 2 meters! Photo Credit: Arnstein Rønning goo.gl/f9HLYB

Each tentacle cluster of a lion’s mane jellyfish can have up to 100 tentacles! Photo Credit: Derek Keats goo.gl/CA1KK3

Here’s the barcode sequence information for this species:

Process ID: CCSMA230-10

nucleotide sequence

AACATTATATTTAATATTTGGTGCTTTTTCAGCCATGATTGGTACAGCTTTTAGTATGATAATAAGATTAGAGCTCTCAGGCCCAGGGTCTATGCTCGGAGACGACCAAATATATAATGTTATAGTAACAGCTCATGCTCTTGTTATGATATTCTTTTTTGTGATGCCCGTGTTGATTGGGGGTTTCGGAAATTGATTTGTCCCACTATATATTGGAAGTCCAGATATGGCTTTCCCTAGACTTAATAACATTAGTTTTTGATTATTACCTCCAGCCCTCCTATTATTATTAGGGTCTTCCTTAATTGAACAAGGAGCTGGAACAGGTTGGACTATTTATCCTCCTCTATCTTCCATACAATTTCATTCTGGGGGGTCAGTAGATATGGCTATATTTAGTTTACATTTAGCTGGTGCTTCCTCTATAATGGGAGCCATAAATTTTATAACAACAATTTTTAACATGAGAGCTCCGGGTATGTCAATGGATAGGTTGCCTCTATTTGTATGGTCAGTACTGGTAACAGCCATTCTTTTACTATTATCCTTACCTGTGTTAGCTGGGGCAATTACAATGTTATTAACAGACAGGAATTTTAANACCTCTTTTTTCGACCCCGCAGGCGGAGGAGACCCAATCTTGTTTCAACACCTATTT

amino acid sequence

TLYLIFGAFSAMIGTAFSMIIRLELSGPGSMLGDDQIYNVIVTAHALVMIFFFVMPVLIGGFGNWFVPLYIGSPDMAFPRLNNISFWLLPPALLLLLGSSLIEQGAGTGWTIYPPLSSIQFHSGGSVDMAIFSLHLAGASSIMGAINFITTIFNMRAPGMSMDRLPLFVWSVLVTAILLLLSLPVLAGAITMLLTDRNFXTSFFDPAGGGDPILFQHLF

Learn more about it’s BIN (Barcode Index Number): BOLD:AAF9673

51/150: A pea, or not a pea?

Posted on May 4, 2017May 4, 2017 by Kristin Rodrigo

Plantae: Magnoliophyta: Magnoliopsida: Fabales: Fabaceae: Lupinus: Lupinus sericeus (Pursh)

As attractive and colourful as this pea family member may be, the silky lupine holds its own dark secrets. Native to Manitoba and British Columbia in Western Canada, this stunning plant has been discovered to produce toxic alkaloids known to cause adverse consequences and even death to its consumers, which are typically domesticated livestock such as sheep, goats and cattle. Continue reading “51/150: A pea, or not a pea?” →

39/150: Are they centipedes or….??

Posted on April 5, 2017August 17, 2017 by Kristin Rodrigo

animalia: Arthropoda: Symphyla: Symphyla order incertae sedis: Scolopendrellidae

Also known as symphylans or garden centipedes, pseudocentipedes are only distant relatives of true centipedes! They are actually more closely related to pauropods and millipedes of the same subphylum Myriapoda. Continue reading “39/150: Are they centipedes or….??” →

37/150: The real-life Cyclops

Posted on March 31, 2017August 17, 2017 by Kristin Rodrigo

animalia: Arthropoda: Maxillopoda: Cyclopoida: Cyclopidae: Cyclops

Though the name might seem fitting for a monster, Cyclops is a small copepod that happens to share the same body characteristic of a single large eye on its head region with the mythological giant. Continue reading “37/150: The real-life Cyclops” →

27/150: The small priceless gems of freshwater ecosystems

Posted on March 8, 2017August 17, 2017 by Kristin Rodrigo

Animalia: Arthropoda: Malacostraca: Amphipoda: Hyalellidae: Hyalella: Hyalella azteca (Saussure, 1858)

Amphipods are common crustaceans that are found in freshwater bodies such as lakes and rivers and Hyalella azteca is one of the most abundant in North America. Due to their small size, these animals mainly feed on diatoms, algae and organic detritus. Continue reading “27/150: The small priceless gems of freshwater ecosystems” →

13/150: Did the opossum play possum?

Posted on February 3, 2017 by Kristin Rodrigo

Animalia: Chordata: Mammalia: Didelphimorphia: Didelphidae: Didelphis: Didelphis virginiana (Kerr, 1792)

The Virginia opossum is the only marsupial found in North America. These furry creatures are also one of the oldest mammals on the planet, dating to at least 70 million years ago! Often wrongly mistaken for rodents, the Virginia opossums do not possess hair on their large ears and their tails, with the exception of its base. Continue reading “13/150: Did the opossum play possum?” →