143/150: Monarchs aren’t the only ones that need milkweed


Warning: Use of undefined constant full - assumed 'full' (this will throw an Error in a future version of PHP) in /home/bio/public_html/biobus.ca/wp/wp-content/themes/biobus-blog/template-parts/content.php on line 22
Animalia: Arthropoda: Insecta: Hemiptera: Lygaeidae: Oncopeltus: Oncopeltus fasciatus: (Dallas, 1852)

Large milkweed bugs are a member of the family Lygaeidae, otherwise known as seed bugs. They get their name from their association with the milkweed plant. They lay their eggs in milkweed pod crevasses and the seeds provide a food and defense source for them. Through eating the seeds, milkweed bugs sequester toxins, which act as a chemical defense against predators. Just like monarch butterflies that also eat milkweed, the large milkweed bug bears the daunting colours of black and orange. This colouration acts as a warning signal for predators to say: “I’m not going to be as tasty as you think.” One interesting misidentification that is commonly made is between these and Box Elder bugs. Despite being the same colour scheme and being roughly the same size, you can tell by the patterns of red on their black wings (seen in the photo below). Those black and orange bugs you seen in the news as pests in large numbers are probably box elder bugs, and not large milkweed bugs. #Canada150 #Biodiversity150

The Large Milkweed bug – Specimen CNC#HEM400640 – Perth, Ontario – 13-Sep-2008
The Large Milkweed Bug is depicted on the left, and the Box Elder bug on the right. Photo Credit: Katja Schulz goo.gl/R9BPFH & Judy Gallagher goo.gl/nS59Zp
A Large Milkweed Bug on a leaf. Photo Credit: Ryan Hodnett goo.gl/81NCCK

Here’s the barcode sequence information for this species:

Process ID: CRHIA649-16

nucleotide sequence

ATATTTGGAATATGATCTGGAATAGTAGGTTCATCAATAAGATGAATTATTCGAATTGAATTAGGTCAACCAGGTATATTTATTGGAAATGACCAAATTTATAATGTAATTGTAACAGCCCATGCATTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGTGGCTTCGGAAACTGACTAGTACCTTTAATAATTGGAGCACCTGATATAGCATTTCCACGAATAAATAATATAAGATTCTGATTATTACCACCTTCATTAACCCTTCTTTTATCTAGAAGAATTACAGAAAGAGGAGCTGGAACAGGATGAACTGTTTATCCTCCTCTATCTAATAGAATTTTTCACAGAGGAGCATCTGTAGATATGGCTATTTTTTCTCTACATTTAGCAGGAATTTCATCAATTCTGGGTGCAATTAATTTTATTTCAACAATTATTAACATACGACCAACAGGTATGTCTTTAGAAAAAACCCCTTTATTTGTATGATCAGTAGGAATTACAGCTCTATTGCTTCTATTATCCTTACCTGTATTAGCAGGAGCAATCACAATACTATTAACTGAT——————————————————

amino acid sequence

MFGMWSGMVGSSMSWIIRIELGQPGMFIGNDQIYNVIVTAHAFIMIFFMVMPIMIGGFGNWLVPLMIGAPDMAFPRMNNMSFWLLPPSLTLLLSSSITESGAGTGWTVYPPLSNSIFHSGASVDMAIFSLHLAGISSILGAINFISTIINMRPTGMSLEKTPLFVWSVGITALLLLLSLPVLAGAITMLLTD——————

Visual representation of DNA barcode sequence for Milkweed bug

Learn more about it’s BIN (Barcode Index Number): BOLD:AAG8878

127/150: Happy Halloween! The Masked Hunter wears a costume of disguise!


Warning: Use of undefined constant full - assumed 'full' (this will throw an Error in a future version of PHP) in /home/bio/public_html/biobus.ca/wp/wp-content/themes/biobus-blog/template-parts/content.php on line 22
Animalia: Arthropoda: Insecta: Hemiptera: Reduviidae: Reduviinae: Reduvius: Reduvius personatus (Linnaeus, 1758)

The Masked Hunter is a true bug belonging to the family Reduviidae, also known as the Assassin Bugs. In accordance to their dangerous sounding common name they are known to have a painful bite, but they are relatively harmless towards humans as they don’t feed on blood or transmit diseases. The nymphs of this species are very interesting because they exude a sticky substance from “head to toe” allowing them to collect dust, lint and other particles. This natural camouflage enables them to ambush their unsuspecting prey. The next time you see a dust bunny floating around your house take a closer look as it may be a Masked Hunter in disguise! #Canada150 #Biodiversity150 #Halloween

Specimen CNC#HEM300372 – Osoyoos, British Columbia – 20-Jun-2005. Photo Credit: CNC/BIO Photography Group, Centre for Biodiversity Genomics
A Masked Hunter nymph covered in sand as its costume for Halloween! Photo Credit: Chiswick Chap goo.gl/6FKrhN
Close-up view of the Masked Hunters piercing mouthparts. Photo Credit: Thomas Pieper goo.gl/H5PXkw

Here’s the barcode sequence information for this species:

Process ID: HMCN586-09

nucleotide sequence

AACTCTTTATTTTCTCTTCGGTGGCTGGGCAGGTATAGTAGGAACATCGCTCAGATGATTAATTCGAATTGAATTAGGACAACCAGGATCCTTCATCGGTGATGACCAAACATATAATGTTATAGTTACTGCACATGCATTCATTATGATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGGAACTGATTAGTACCCTTAATGATTGGGGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCCCCATCTCTCACTCTCTTAATTATAAGAAGTATTGTAGAAACAGGGGCAGGAACAGGATGAACCGTTTACCCCCCTCTATCAAGAAATATGAGACATGCAGGTGCATCCGTTGACCTTGCAATTTTTTCTCTTCACCTAGCAGGGATTTCATCAATCTTAGGAGCAATAAATTTTATTTCAACCATCATCAATATACGAACCGCGGGAATAACCCCCGAACGGATCCCTCTTTTTGTTTGATCAGTTGGTATTACTGCACTTCTCCTACTTCTCTCTTTACCTGTCCTAGCAGGAGCAATTACTATACTCCTAACAGATCGAAACTTTAATACAAGATTTTTTGACCCAGCTGGAGGGGGGGATCCTATTTTATATCAACATTTATTT

amino acid sequence

TLYFLFGGWAGMVGTSLSWLIRIELGQPGSFIGDDQTYNVMVTAHAFIMIFFMVMPIMIGGFGNWLVPLMIGAPDMAFPRMNNMSFWLLPPSLTLLIMSSIVETGAGTGWTVYPPLSSNMSHAGASVDLAIFSLHLAGISSILGAMNFISTIINMRTAGMTPERIPLFVWSVGITALLLLLSLPVLAGAITMLLTDRNFNTSFFDPAGGGDPILYQHLF

Visual representation of DNA barcode sequence for Masked Hunter Bug

Learn more about it’s BIN (Barcode Index Number): BOLD:AAH2979