Tag: Camouflage

127/150: Happy Halloween! The Masked Hunter wears a costume of disguise!

Posted on by Renee Miskie
Animalia: Arthropoda: Insecta: Hemiptera: Reduviidae: Reduviinae: Reduvius: Reduvius personatus (Linnaeus, 1758)

The Masked Hunter is a true bug belonging to the family Reduviidae, also known as the Assassin Bugs. In accordance to their dangerous sounding common name they are known to have a painful bite, but they are relatively harmless towards humans as they don’t feed on blood or transmit diseases. The nymphs of this species are very interesting because they exude a sticky substance from “head to toe” allowing them to collect dust, lint and other particles. This natural camouflage enables them to ambush their unsuspecting prey. The next time you see a dust bunny floating around your house take a closer look as it may be a Masked Hunter in disguise! #Canada150 #Biodiversity150 #Halloween

Specimen CNC#HEM300372 – Osoyoos, British Columbia – 20-Jun-2005. Photo Credit: CNC/BIO Photography Group, Centre for Biodiversity Genomics
A Masked Hunter nymph covered in sand as its costume for Halloween! Photo Credit: Chiswick Chap goo.gl/6FKrhN
Close-up view of the Masked Hunters piercing mouthparts. Photo Credit: Thomas Pieper goo.gl/H5PXkw

Here’s the barcode sequence information for this species:

Process ID: HMCN586-09

nucleotide sequence

AACTCTTTATTTTCTCTTCGGTGGCTGGGCAGGTATAGTAGGAACATCGCTCAGATGATTAATTCGAATTGAATTAGGACAACCAGGATCCTTCATCGGTGATGACCAAACATATAATGTTATAGTTACTGCACATGCATTCATTATGATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGGAACTGATTAGTACCCTTAATGATTGGGGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCCCCATCTCTCACTCTCTTAATTATAAGAAGTATTGTAGAAACAGGGGCAGGAACAGGATGAACCGTTTACCCCCCTCTATCAAGAAATATGAGACATGCAGGTGCATCCGTTGACCTTGCAATTTTTTCTCTTCACCTAGCAGGGATTTCATCAATCTTAGGAGCAATAAATTTTATTTCAACCATCATCAATATACGAACCGCGGGAATAACCCCCGAACGGATCCCTCTTTTTGTTTGATCAGTTGGTATTACTGCACTTCTCCTACTTCTCTCTTTACCTGTCCTAGCAGGAGCAATTACTATACTCCTAACAGATCGAAACTTTAATACAAGATTTTTTGACCCAGCTGGAGGGGGGGATCCTATTTTATATCAACATTTATTT

amino acid sequence

TLYFLFGGWAGMVGTSLSWLIRIELGQPGSFIGDDQTYNVMVTAHAFIMIFFMVMPIMIGGFGNWLVPLMIGAPDMAFPRMNNMSFWLLPPSLTLLIMSSIVETGAGTGWTVYPPLSSNMSHAGASVDLAIFSLHLAGISSILGAMNFISTIINMRTAGMTPERIPLFVWSVGITALLLLLSLPVLAGAITMLLTDRNFNTSFFDPAGGGDPILYQHLF

Visual representation of DNA barcode sequence for Masked Hunter Bug

Learn more about it’s BIN (Barcode Index Number): BOLD:AAH2979

100/150: Phasmids, the masters of disguise!

Posted on by Katelyn Hill
Animalia: Arthropoda: Insecta: Phasmatodea: Diapheromeridae: Diapheromerinae: Diapheromera: Diapheromera femorata (Say, 1824)

The common walking stick (Diapheromera femorata) is the only species walking stick found in Canada.  Phasmids are excellent at camouflage and are commonly mistaken for twigs and leaves, accomplishing this feat by body modifications that resemble leaf veins and bark like tubercles. Phasmids will also sway back in forth, resembling leaves in the wind. Continue reading “100/150: Phasmids, the masters of disguise!” →

45/150: Cephalopods are Insane in the Membrane

Posted on by Emma Eberl
Animalia: Mollusca: Cephalopoda: Teuthida: Loliginidae: Doryteuthis: Doryteuthis opalescens (Berry, 1911)

The opalescent inshore squid, Dorytheuthis opalescens, can be found along the Pacific coast from Alaska to Mexico. They are part of the myopsid squids, meaning that they have a cornea unlike other cephalopods as it is covered in a corneal membrane instead of a second eyelid. Continue reading “45/150: Cephalopods are Insane in the Membrane” →