131/150: What has a lion’s mane and lives under the sea? A jellyfish!

Posted on November 9, 2017 by Kristin Rodrigo

Warning: Use of undefined constant full - assumed 'full' (this will throw an Error in a future version of PHP) in /home/bio/public_html/biobus.ca/wp/wp-content/themes/biobus-blog/template-parts/content.php on line 22

Animalia: Cnidaria: Scyphozoa: Semaeostomeae: Cyaneidae: Cyanea: Cyanea capillata (Linnaeus, 1758)

The Lion’s Mane jellyfish is the largest species of jellyfish in the world. The largest specimen was found in 1870 at Massachusetts Bay, United States with a bell diameter of 2.3 meters and tentacles reaching 37 meters, which is longer than the length of a blue whale! These magnificent creatures are known to like cold temperatures and live around northern hemisphere in the north Atlantic, Pacific and Arctic oceans. Due to their large size, certain fish and shrimp species find protection and shelter from their predators by hiding around the jellyfish’s body. As for their diet, the lion’s mane jellyfish’s favourites are zooplankton, moon jellies and ctenophores. They live a pelagic lifestyle, roaming around open seas and often fall to prey to seabirds, ocean sunfish and other jellyfish species. In fact, the leatherback sea turtle feeds almost entirely on this species. Uhm, yum? #Canada150 #Biodiversity150

Small, juvenile lion’s mane jellyfish appear in tan and orange colours, but as they get older, they turn into a reddish or purplish shade. Photo Credit: Brian Gratwicke goo.gl/DkBexQ

The bell of the lion’s mane jellyfish can reach a diameter of 2 meters! Photo Credit: Arnstein Rønning goo.gl/f9HLYB

Each tentacle cluster of a lion’s mane jellyfish can have up to 100 tentacles! Photo Credit: Derek Keats goo.gl/CA1KK3

Here’s the barcode sequence information for this species:

Process ID: CCSMA230-10

nucleotide sequence

AACATTATATTTAATATTTGGTGCTTTTTCAGCCATGATTGGTACAGCTTTTAGTATGATAATAAGATTAGAGCTCTCAGGCCCAGGGTCTATGCTCGGAGACGACCAAATATATAATGTTATAGTAACAGCTCATGCTCTTGTTATGATATTCTTTTTTGTGATGCCCGTGTTGATTGGGGGTTTCGGAAATTGATTTGTCCCACTATATATTGGAAGTCCAGATATGGCTTTCCCTAGACTTAATAACATTAGTTTTTGATTATTACCTCCAGCCCTCCTATTATTATTAGGGTCTTCCTTAATTGAACAAGGAGCTGGAACAGGTTGGACTATTTATCCTCCTCTATCTTCCATACAATTTCATTCTGGGGGGTCAGTAGATATGGCTATATTTAGTTTACATTTAGCTGGTGCTTCCTCTATAATGGGAGCCATAAATTTTATAACAACAATTTTTAACATGAGAGCTCCGGGTATGTCAATGGATAGGTTGCCTCTATTTGTATGGTCAGTACTGGTAACAGCCATTCTTTTACTATTATCCTTACCTGTGTTAGCTGGGGCAATTACAATGTTATTAACAGACAGGAATTTTAANACCTCTTTTTTCGACCCCGCAGGCGGAGGAGACCCAATCTTGTTTCAACACCTATTT

amino acid sequence

TLYLIFGAFSAMIGTAFSMIIRLELSGPGSMLGDDQIYNVIVTAHALVMIFFFVMPVLIGGFGNWFVPLYIGSPDMAFPRLNNISFWLLPPALLLLLGSSLIEQGAGTGWTIYPPLSSIQFHSGGSVDMAIFSLHLAGASSIMGAINFITTIFNMRAPGMSMDRLPLFVWSVLVTAILLLLSLPVLAGAITMLLTDRNFXTSFFDPAGGGDPILFQHLF

Learn more about it’s BIN (Barcode Index Number): BOLD:AAF9673

105/150: Sea pens – not your typical corals

Posted on September 7, 2017 by Danielle Wright

Animalia: Cnidaria: Anthozoa: Pennatulacea: Pennatulidae: Pennatula: Pennatula aculeata (Danielssen, 1860)

Sea pens are colonial marine cnidarians found worldwide and normally at depths greater than 10 meters. Sea pens prefer deeper waters because they can avoid uprooting due to water turbulence. They live most of their lives in a sessile (immobile) state, however they can relocate and anchor themselves in more desirable areas where steadier streams of their food source, plankton, might be found. Continue reading “105/150: Sea pens – not your typical corals” →

30/150: Hail Hydra! The immortal cnidarian

Posted on March 15, 2017August 17, 2017 by Danielle Wright

animalia: Cnidaria: Hydrozoa: Anthoathecata: Hydridae: Hydra: Hydra canadensis (Rowan, 1930)

From Marvel movies to Greek mythology, ‘Hydra’ is a familiar word referring to a many headed monster that can regenerate heads for every one cut off. It sounds far-fetched, but in fact, is exactly what the freshwater cnidarian can do. Hydra is a genus containing tubular radially symmetric organisms that are a maximum of 1 cm long. Their tentacles contain the same stinging cells (or cnidocytes) found in anemones and jellyfish, that can fire bursts of neurotoxin when triggered by prey. If Hydra are attacked they can recoil into a small gelatinous sphere to protect themselves. Hydra can reproduce both sexually and asexually, depending on environmental conditions like food abundance. Hydra have a remarkable ability to regenerate after they’ve been injured, growing new feet from head fragments, and vice versa, thanks to their bodies being composed mostly of stem cells. They also appear to be immortal; showing no signs of deteriorating with age under idealistic conditions. Definitely cool! #HailHydra #Canada150 #Biodiversity150