Animalia: Chordata: Myxini: Myxiniformes: Myxinidae: Eptatretinae: Eptatretus: Eptatretus stoutii (Lockington, 1878)
The Pacific Hagfish is a jawless fish species that has a long, eel-like body. They are boneless, with only cartilage and keratin structures and flexible enough they can tie themselves into knots – a useful tool for applying some biting force when you have no jaw! They live up to 1000 meters below the surface, and feed on the carcasses of various aquatic animals, although they can go months without food. They are most famous for their unique predator evasion method: creating bucket loads of slime. Their skin is loose, and packed with slime glands, which – when grabbed by the biting mouth of a potential predator – release copious amounts of slime proteins. These fish can produce an immense quantity of slime in seconds, which makes them slippery and clogs up the mouths, and gills, of their attackers. Unfortunately their population is thought to be declining, because of their value in Asian eel-leather markets. #HagfishDay #Canada150 #Biodiversity150



Here’s the barcode sequence information for this species:
Process ID: TZFPA151-07
nucleotide sequence
CCTTTATCTAATTTTTGGTGCATGAGCCGGAATAATCGGAACAGCTTTAAGTGTAATTATTCGAACAGAATTAAGCCAACCAGGGCCCTTAATTAACAATGACCAACTTTATAATACAATCATCACAGCCCATGCATTCATTATAATTTTCTTCATAGTTATACCAATTATAATTGGTGGTTTTGGAAACTGACTAGTACCATTAATAATTGGTGCACCAGATATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTTCCCCCTTCACTCCTTCTTCTACTTTCATCTTCCATAATTAGTTCTGGTGCAGGAACTGGGTGAACTGTTTACCCACCCCTTTCAAATCATATTTCACATATAGGCCCATCAGTAGATTTAACTATTTTCTCACTACACCTAGCAGGTGTTTCTTCCATTTTAGGAGCAATCAACTTTATCACTACTATTATCAACATAAAAATACAATCAATAACCATATATCACATCCCATTATTTGTATGATCAATCCTAATCACCACAATTTTACTTCTCCTTTCCCTGCCAGTTTTAGCTGCTGCCATCACTATACTACTTACTGATCGTAATCTCAATACTACCTTTTTCGATCCTTCTGGTGGAGGAGATCCTATCCTTTATCAACACCT-
amino acid sequence
LYLIFGAWAGMIGTALSVIIRTELSQPGPLINNDQLYNTIITAHAFIMIFFMVMPIMIGGFGNWLVPLMIGAPDMAFPRMNNMSFWLLPPSLLLLLSSSMISSGAGTGWTVYPPLSNHISHMGPSVDLTIFSLHLAGVSSILGAINFITTIINMKMQSMTMYHIPLFVWSILITTILLLLSLPVLAAAITMLLTDRNLNTTFFDPSGGGDPILYQHX
Learn more about it’s BIN (Barcode Index Number): BOLD:AAC6695