131/150: What has a lion’s mane and lives under the sea? A jellyfish!


Warning: Use of undefined constant full - assumed 'full' (this will throw an Error in a future version of PHP) in /home/bio/public_html/biobus.ca/wp/wp-content/themes/biobus-blog/template-parts/content.php on line 22
Animalia: Cnidaria: Scyphozoa: Semaeostomeae: Cyaneidae: Cyanea: Cyanea capillata (Linnaeus, 1758)

The Lion’s Mane jellyfish is the largest species of jellyfish in the world. The largest specimen was found in 1870 at Massachusetts Bay, United States with a bell diameter of 2.3 meters and tentacles reaching 37 meters, which is longer than the length of a blue whale! These magnificent creatures are known to like cold temperatures and live around northern hemisphere in the north Atlantic, Pacific and Arctic oceans. Due to their large size, certain fish and shrimp species find protection and shelter from their predators by hiding around the jellyfish’s body. As for their diet, the lion’s mane jellyfish’s favourites are zooplankton, moon jellies and ctenophores. They live a pelagic lifestyle, roaming around open seas and often fall to prey to seabirds, ocean sunfish and other jellyfish species. In fact, the leatherback sea turtle feeds almost entirely on this species. Uhm, yum? #Canada150 #Biodiversity150

Small, juvenile lion’s mane jellyfish appear in tan and orange colours, but as they get older, they turn into a reddish or purplish shade. Photo Credit: Brian Gratwicke goo.gl/DkBexQ
The bell of the lion’s mane jellyfish can reach a diameter of 2 meters! Photo Credit: Arnstein Rønning goo.gl/f9HLYB
Each tentacle cluster of a lion’s mane jellyfish can have up to 100 tentacles! Photo Credit: Derek Keats goo.gl/CA1KK3

Here’s the barcode sequence information for this species:

Process ID: CCSMA230-10

nucleotide sequence

AACATTATATTTAATATTTGGTGCTTTTTCAGCCATGATTGGTACAGCTTTTAGTATGATAATAAGATTAGAGCTCTCAGGCCCAGGGTCTATGCTCGGAGACGACCAAATATATAATGTTATAGTAACAGCTCATGCTCTTGTTATGATATTCTTTTTTGTGATGCCCGTGTTGATTGGGGGTTTCGGAAATTGATTTGTCCCACTATATATTGGAAGTCCAGATATGGCTTTCCCTAGACTTAATAACATTAGTTTTTGATTATTACCTCCAGCCCTCCTATTATTATTAGGGTCTTCCTTAATTGAACAAGGAGCTGGAACAGGTTGGACTATTTATCCTCCTCTATCTTCCATACAATTTCATTCTGGGGGGTCAGTAGATATGGCTATATTTAGTTTACATTTAGCTGGTGCTTCCTCTATAATGGGAGCCATAAATTTTATAACAACAATTTTTAACATGAGAGCTCCGGGTATGTCAATGGATAGGTTGCCTCTATTTGTATGGTCAGTACTGGTAACAGCCATTCTTTTACTATTATCCTTACCTGTGTTAGCTGGGGCAATTACAATGTTATTAACAGACAGGAATTTTAANACCTCTTTTTTCGACCCCGCAGGCGGAGGAGACCCAATCTTGTTTCAACACCTATTT

amino acid sequence

TLYLIFGAFSAMIGTAFSMIIRLELSGPGSMLGDDQIYNVIVTAHALVMIFFFVMPVLIGGFGNWFVPLYIGSPDMAFPRLNNISFWLLPPALLLLLGSSLIEQGAGTGWTIYPPLSSIQFHSGGSVDMAIFSLHLAGASSIMGAINFITTIFNMRAPGMSMDRLPLFVWSVLVTAILLLLSLPVLAGAITMLLTDRNFXTSFFDPAGGGDPILFQHLF

Visual representation of DNA barcode sequence for Lion's mane jellyfish

Learn more about it’s BIN (Barcode Index Number): BOLD:AAF9673

Natural treasures of the west coast of Vancouver Island


Warning: Use of undefined constant full - assumed 'full' (this will throw an Error in a future version of PHP) in /home/bio/public_html/biobus.ca/wp/wp-content/themes/biobus-blog/template-parts/content.php on line 22

Pacific Rim National Park Reserve of Canada is a thin strip of land along the southwestern coast of Vancouver Island and is characterized by rugged coasts and lush temperate rainforests. Imagine white sandy coastlines, eagles soaring overhead, ferns, and cushions of moss hanging from the branches of towering Sitka spruce, and the ocean stretching off as far as the eye can see. Continue reading “Natural treasures of the west coast of Vancouver Island”