147/150: Nutty Facts about the Peanut Worm!

Animalia: Sipuncula: Phascolosomatidea: Phascolosomatida: Phascolosomatidae: Phascolosoma agassizii (Henri Marie Ducrotay de Blainville, 1827)

Peanut worms, also known as Sipunculids are marine worms in that typically dwell in shallow waters. Sipuncula means “little tube” or “siphon” in Latin and refers to the introvert of peanut worms, a long sensitive tube ringed with tentacles which they can extend to collect food. Continue reading “147/150: Nutty Facts about the Peanut Worm!”

131/150: What has a lion’s mane and lives under the sea? A jellyfish!

Animalia: Cnidaria: Scyphozoa: Semaeostomeae: Cyaneidae: Cyanea: Cyanea capillata (Linnaeus, 1758)

The Lion’s Mane jellyfish is the largest species of jellyfish in the world. The largest specimen was found in 1870 at Massachusetts Bay, United States with a bell diameter of 2.3 meters and tentacles reaching 37 meters, which is longer than the length of a blue whale! These magnificent creatures are known to like cold temperatures and live around northern hemisphere in the north Atlantic, Pacific and Arctic oceans. Due to their large size, certain fish and shrimp species find protection and shelter from their predators by hiding around the jellyfish’s body. As for their diet, the lion’s mane jellyfish’s favourites are zooplankton, moon jellies and ctenophores. They live a pelagic lifestyle, roaming around open seas and often fall to prey to seabirds, ocean sunfish and other jellyfish species. In fact, the leatherback sea turtle feeds almost entirely on this species. Uhm, yum? #Canada150 #Biodiversity150

Small, juvenile lion’s mane jellyfish appear in tan and orange colours, but as they get older, they turn into a reddish or purplish shade. Photo Credit: Brian Gratwicke goo.gl/DkBexQ
The bell of the lion’s mane jellyfish can reach a diameter of 2 meters! Photo Credit: Arnstein Rønning goo.gl/f9HLYB
Each tentacle cluster of a lion’s mane jellyfish can have up to 100 tentacles! Photo Credit: Derek Keats goo.gl/CA1KK3

Here’s the barcode sequence information for this species:

Process ID: CCSMA230-10

nucleotide sequence

AACATTATATTTAATATTTGGTGCTTTTTCAGCCATGATTGGTACAGCTTTTAGTATGATAATAAGATTAGAGCTCTCAGGCCCAGGGTCTATGCTCGGAGACGACCAAATATATAATGTTATAGTAACAGCTCATGCTCTTGTTATGATATTCTTTTTTGTGATGCCCGTGTTGATTGGGGGTTTCGGAAATTGATTTGTCCCACTATATATTGGAAGTCCAGATATGGCTTTCCCTAGACTTAATAACATTAGTTTTTGATTATTACCTCCAGCCCTCCTATTATTATTAGGGTCTTCCTTAATTGAACAAGGAGCTGGAACAGGTTGGACTATTTATCCTCCTCTATCTTCCATACAATTTCATTCTGGGGGGTCAGTAGATATGGCTATATTTAGTTTACATTTAGCTGGTGCTTCCTCTATAATGGGAGCCATAAATTTTATAACAACAATTTTTAACATGAGAGCTCCGGGTATGTCAATGGATAGGTTGCCTCTATTTGTATGGTCAGTACTGGTAACAGCCATTCTTTTACTATTATCCTTACCTGTGTTAGCTGGGGCAATTACAATGTTATTAACAGACAGGAATTTTAANACCTCTTTTTTCGACCCCGCAGGCGGAGGAGACCCAATCTTGTTTCAACACCTATTT

amino acid sequence

TLYLIFGAFSAMIGTAFSMIIRLELSGPGSMLGDDQIYNVIVTAHALVMIFFFVMPVLIGGFGNWFVPLYIGSPDMAFPRLNNISFWLLPPALLLLLGSSLIEQGAGTGWTIYPPLSSIQFHSGGSVDMAIFSLHLAGASSIMGAINFITTIFNMRAPGMSMDRLPLFVWSVLVTAILLLLSLPVLAGAITMLLTDRNFXTSFFDPAGGGDPILFQHLF

Visual representation of DNA barcode sequence for Lion's mane jellyfish

Learn more about it’s BIN (Barcode Index Number): BOLD:AAF9673

105/150: Sea pens – not your typical corals

Animalia: Cnidaria: Anthozoa: Pennatulacea: Pennatulidae: Pennatula: Pennatula aculeata (Danielssen, 1860)

Sea pens are colonial marine cnidarians found worldwide and normally at depths greater than 10 meters. Sea pens prefer deeper waters because they can avoid uprooting due to water turbulence. They live most of their lives in a sessile (immobile) state, however they can relocate and anchor themselves in more desirable areas where steadier streams of their food source, plankton, might be found. Continue reading “105/150: Sea pens – not your typical corals”

93/150: What a big mouth!

Animalia: Chordata: Elasmobranchii: Lamniformes: Cetorhinidae: Cetorhinus: Cetorhinus maximus  (Gunnerus, 1765)

Basking sharks are known as the second biggest fish in the ocean reaching lengths of up to 10 metres and weighing almost 6 tonnes! But unlike its menacing cousins the basking shark is a gentle creature that feeds on small organisms such as plankton through filter-feeding. By using a thousand bristle-like structures on their gills and a mouth that can reach 1 metre in diameter they create a passive net and filtering system. Continue reading “93/150: What a big mouth!”

64/150: Birds of the Sea

Animalia: Echinodermata: Crinoidea: Comatulida: Antedonidae: Heliometrinae: Florometra: Florometra serratissima (AH Clark, 1907)

While you wouldn’t think birds would be able to exist in the ocean, the common feather star Florometra serratissima could very well be considered the bird of the sea! They are able to move around either by grasping terrain with their claw-like cirri or by swimming through the water with their feather-like arms. Continue reading “64/150: Birds of the Sea”

63/150: The Ultimate Diving Champion

animalia: Chordata: Aves: Anseriformes: Anatidae: Clangula: Clangula hyemalis (Linnaeus, 1758)

Now this species is set for the Olympics! The Long-tailed Duck (Clangula hyemalis) – formerly known as Oldsquaw – sets the record for one of the deepest diving ducks (over 60 metres)! Whereas Olympic athletes perform impressive feats like these for medals, the Long-tailed Duck must dive to survive. Continue reading “63/150: The Ultimate Diving Champion”