145/150: Coneheads. (No, I’m not talking about the nineties movie)


Warning: Use of undefined constant full - assumed 'full' (this will throw an Error in a future version of PHP) in /home/bio/public_html/biobus.ca/wp/wp-content/themes/biobus-blog/template-parts/content.php on line 22
Animalia: Arthropoda: Protura: Eosentomata:  Eosentomidae Berlese, 1909

Look closely, you don’t want to miss them! These proturans are less than 2 mm in length and lack wings, antennae, eyes and pigment; producing an almost see through body. Although they lack some arguably important body parts, they make up for it in other unique ways. They are quadrupeds because their front legs, which are segmented into 5 parts, lost the ability to support their weight and adapted to function as antennae. Furthermore, their bodies are covered in sensory hairs that aid in types of temperature, chemical, humidity and vibrational sensing. Coneheads exhibit anamorphosis, the number of abdominal segments increases with subsequent molts until they reach the adult’s full twelve. Although hard to spot, coneheads can be incredibly numerous in places with moss, leaf litter, decaying wood and temperate forest soils. Their diets are somewhat of a mystery much like the rest of their ecology but have been observed feeding on a mycorrhiza, a fungus that lives on plant roots and fungal hyphae, and in terms of economic importance they are part of the community of decomposers that aid in breaking down and recycling organic nutrients. Overall, there’s more than what meets the eye with these tiny creatures! #Canada150 #Biodiversity150

Specimen BIOUG26318-D08 – Long Point Prpvincial Park, Ontario – 14-July-2015 – Berlese Funnel
A Conehead on what may be soil or decaying wood. Photo Credit: Andy Murray goo.gl/ic3Zcn
A Conehead possibly feeding on a fungus. Photo Credit Andy Murray goo.gl/3V5A25

Here’s the barcode sequence information for this species:

Process ID: SWJNH052-15

nucleotide sequence

AGGCTATATTTCGTTTTTGGGAGGTGATCTGCAATATTAGGTACTTCTTTAAGATTGTTGATTCGTATTGAACTCGGTAGAGCTGGACAATTTCTAGGGAACGACCAGATCTATAATGTAATTGTGACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTTTAATTGGGGGGTTTGGTAATTGGCTAGTCCCATTAATATTAAGGAGCCCTGACATAGCCTTTCCTCGAATAAATAATTTAAGATTCTGGCTTCTTCCTCCTTCTTTATTGTTATTAGTTTTAAGAAGAATTATTGAAATAGGTGTGGGCACGGGGTGGACTGTGTATCCCCCGCTATCTTCCAACTTAGCTCATTTAGGAGTATCTGTAGATCTTGGGATTTTTTCATTACACCTTGCTGGAGCATCTTCTATTCTAGGGGCTATTAATTTTATTACTACTATTGCTAATTCACGAGGGTTTAAGATTAAAATAGAAAATGTTTCATTATTTAGCTGATCTGTATTATTAACTGCAATCTTACTTCTATTGTCTCTTCCTGTTTTAGCCGGTGCCATTACTATACTTTTAACGGATCGTAATATTAATACTTCCTTTTTTGACCCCTTAGGAGGAGGGGACCCTATTTTATTTCAACATCTTTT

amino acid sequence

SLYFVFGSWSAMLGTSLSLLIRIELGSAGQFLGNDQIYNVIVTAHAFIMIFFMVMPILIGGFGNWLVPLMLSSPDMAFPRMNNLSFWLLPPSLLLLVLSSIIEMGVGTGWTVYPPLSSNLAHLGVSVDLGIFSLHLAGASSILGAINFITTIANSRGFKIKMENVSLFSWSVLLTAILLLLSLPVLAGAITMLLTDRNINTSFFDPLGGGDPILFQHLX

Visual representation of DNA barcode sequence for Protura

Learn more about it’s BIN (Barcode Index Number): BOLD:ACY5591

39/150: Are they centipedes or….??


Warning: Use of undefined constant full - assumed 'full' (this will throw an Error in a future version of PHP) in /home/bio/public_html/biobus.ca/wp/wp-content/themes/biobus-blog/template-parts/content.php on line 22
animalia: Arthropoda: Symphyla: Symphyla order incertae sedis: Scolopendrellidae

Also known as symphylans or garden centipedes, pseudocentipedes are only distant relatives of true centipedes! They are actually more closely related to pauropods and millipedes of the same subphylum Myriapoda. Continue reading “39/150: Are they centipedes or….??”

A Mitey Start


Warning: Use of undefined constant full - assumed 'full' (this will throw an Error in a future version of PHP) in /home/bio/public_html/biobus.ca/wp/wp-content/themes/biobus-blog/template-parts/content.php on line 22

Hello everyone, my name is Nathaniel Jones. This is my first blog of the summer. I am currently getting started on my new position here at BIO. I was fortunate enough to land the summer Undergraduate Research Assistantship position to sample the soil for arthropod diversity. So far this week I have just been getting started, learning a lot about the techniques of sampling small soil arthropods. Some of the mites are so tiny I am unable to use forceps, as they are almost microscopic and hard to distinguish from grains of sand. Continue reading “A Mitey Start”