Animalia: Arthropoda: Arachnida: Trombidiformes: Tetranycinae: Tetranychinae: Tetranychus: Tetranychus urticae (C. L. Kock, 1836)
The two-spotted spider mite is of economic importance as it is a common pest worldwide. It has been found to feed on more than 1,100 different species of plants! Including important crops such as maize, soy, citrus, apples, tomatoes, strawberries, and peppers. By sucking the cell contents from leaves, the mite leaves small lesions that in large numbers will reduce the photosynthetic capabilities of plants. It is highly resistant to pesticides so researchers sequenced its entire genome in 2011 to understand its biology to create more effective pesticides.
These mites are barely visible to the naked eye at 0.4 mm long and comes in many colours including brown, orange, and green. It is named for the two spots located symmetrically on each side of its back. These spots are actually the buildup of body waste that can be seen through the mite’s transparent body wall. Like all spider mites, the two-spotted variety can spin fine strands of web. #Canada150 #Biodiversity150
Here’s the barcode sequence information for this species:
Process ID: MBIOC060-13
nucleotide sequence
AACTATGTATTTTTTATTTAGATTATTTTCAGGACTTATAGGGACTTCAATAAGAATTATTATTCGATTAGAACTTATAACACCAGGATCATTAATTCAAAATGATTTTATTTATAATTCAATAGTTACAACGCACGCTATAATTATAATTTTTTTTATAGTTATACCAGCTATAATTGGAGGATTTGGAAATTGATTGATTCCTTTAATAATTAATACTGTAGATTTATGTTTTCCGCGAATTAATAATATAAGATTTTGATTGCTAATTCCTTCTTTAATATTAATAATTTCTTCATCCATAAAAAGTGTTTTAAATGGAGTGGGTTGAACAATATATCCCCCCCTAACTTCAATTCAATATTTTATGTCTTCCTCTATTGAAATAATAATTTTTTCTTTACATATTGCAGGAATTTCTTCAATTGCTAGATCTATTAATTTTATTTCAACTATTCTATTAATAAAAAATAAAAATTATTTTTTAAGAAATTTAACTTTATTTTCTTTATCAATTTTAATTACTACATTTTTACTTTTATTAGCATTACCTGTCTTAGCAGGAGCAATTACAATAATTTTAATAGATCGAAATTTTAATACATCATTTTTTGATCCAAGAGGAGGAGGAGACCCAATTTTATATCAACATTTATTT
amino acid sequence
TMYFLFSLFSGLMGTSMSIIIRLELMTPGSLIQNDFIYNSMVTTHAMIMIFFMVMPAMIGGFGNWLIPLMINTVDLCFPRINNMSFWLLIPSLMLMISSSMKSVLNGVGWTMYPPLTSIQYFMSSSIEMMIFSLHIAGISSIASSINFISTILLMKNKNYFLSNLTLFSLSILITTFLLLLALPVLAGAITMILMDRNFNTSFFDPSGGGDPILYQHL
Learn more about it’s BIN (Barcode Index Number): BOLD:ABY3244
