Tentacles – BIObus

Animalia: Cnidaria: Scyphozoa: Semaeostomeae: Cyaneidae: Cyanea: Cyanea capillata (Linnaeus, 1758)

The Lion’s Mane jellyfish is the largest species of jellyfish in the world. The largest specimen was found in 1870 at Massachusetts Bay, United States with a bell diameter of 2.3 meters and tentacles reaching 37 meters, which is longer than the length of a blue whale! These magnificent creatures are known to like cold temperatures and live around northern hemisphere in the north Atlantic, Pacific and Arctic oceans. Due to their large size, certain fish and shrimp species find protection and shelter from their predators by hiding around the jellyfish’s body. As for their diet, the lion’s mane jellyfish’s favourites are zooplankton, moon jellies and ctenophores. They live a pelagic lifestyle, roaming around open seas and often fall to prey to seabirds, ocean sunfish and other jellyfish species. In fact, the leatherback sea turtle feeds almost entirely on this species. Uhm, yum? #Canada150 #Biodiversity150

Small, juvenile lion’s mane jellyfish appear in tan and orange colours, but as they get older, they turn into a reddish or purplish shade. Photo Credit: Brian Gratwicke goo.gl/DkBexQ

The bell of the lion’s mane jellyfish can reach a diameter of 2 meters! Photo Credit: Arnstein Rønning goo.gl/f9HLYB

Each tentacle cluster of a lion’s mane jellyfish can have up to 100 tentacles! Photo Credit: Derek Keats goo.gl/CA1KK3

Here’s the barcode sequence information for this species:

Process ID: CCSMA230-10

nucleotide sequence

AACATTATATTTAATATTTGGTGCTTTTTCAGCCATGATTGGTACAGCTTTTAGTATGATAATAAGATTAGAGCTCTCAGGCCCAGGGTCTATGCTCGGAGACGACCAAATATATAATGTTATAGTAACAGCTCATGCTCTTGTTATGATATTCTTTTTTGTGATGCCCGTGTTGATTGGGGGTTTCGGAAATTGATTTGTCCCACTATATATTGGAAGTCCAGATATGGCTTTCCCTAGACTTAATAACATTAGTTTTTGATTATTACCTCCAGCCCTCCTATTATTATTAGGGTCTTCCTTAATTGAACAAGGAGCTGGAACAGGTTGGACTATTTATCCTCCTCTATCTTCCATACAATTTCATTCTGGGGGGTCAGTAGATATGGCTATATTTAGTTTACATTTAGCTGGTGCTTCCTCTATAATGGGAGCCATAAATTTTATAACAACAATTTTTAACATGAGAGCTCCGGGTATGTCAATGGATAGGTTGCCTCTATTTGTATGGTCAGTACTGGTAACAGCCATTCTTTTACTATTATCCTTACCTGTGTTAGCTGGGGCAATTACAATGTTATTAACAGACAGGAATTTTAANACCTCTTTTTTCGACCCCGCAGGCGGAGGAGACCCAATCTTGTTTCAACACCTATTT

amino acid sequence

TLYLIFGAFSAMIGTAFSMIIRLELSGPGSMLGDDQIYNVIVTAHALVMIFFFVMPVLIGGFGNWFVPLYIGSPDMAFPRLNNISFWLLPPALLLLLGSSLIEQGAGTGWTIYPPLSSIQFHSGGSVDMAIFSLHLAGASSIMGAINFITTIFNMRAPGMSMDRLPLFVWSVLVTAILLLLSLPVLAGAITMLLTDRNFXTSFFDPAGGGDPILFQHLF

Learn more about it’s BIN (Barcode Index Number): BOLD:AAF9673

Animalia: Annelida: Polychaeta: Sabellida: Sabellidae: Eudistylia: Eudistylia vancouveri (Kinberg, 1866)

You wouldn’t expect that the beautiful Vancouver feather duster (Eudistylia vancouveri) is a type of worm, but that’s exactly what it is. It belongs to a class of segmented bristle worms called Polychaeta within the family Sabellidae, AKA feather duster worms. They are sedentary marine worms that live in parchment-like tubes made of sediment. Their heads are concealed in a feathery crown of colourful tentacles, called radioles, which are used for respiration and filter feeding. Continue reading “15/150: Pretty underwater feather dusters or worms with tentacle eyes? Why not both!” →

Recent